guobioinfolab / catt Goto Github PK

@aqzas @Huffyphenix ，
I am using CATT to extract TCR/BCR information from data from scRNA-seq of immune cells, involving more than 100 datasets. Your article gives a performance comparison of each tool, but is there any comparison in terms of task run speed? This will help me a lot, thanks!

Hello,
I really like the way you are using these tools to characterize T cell receptor sequence in Human, I have pulled the Docker image and try to use it for non-human sample i.e. pig. I am interested in characterizing T cell receptor sequence for Pig. Can you please let me know if I can change reference seq in your docker image/ Dockerfile, that would be very helpful and much appreciated.

With Regards,
Dharm

Hi,

I am experiencing a problem when running the CATT Docker image. The test sample runs fine, but other .fq files fail at the Aligning stage with a LoadError. The files seem to be normal, but they cannot be opened. What could be the cause of this problem?

Hi, thank you for creating CATT, I was impressed by your benchmarks and would like to create a parser for your amazing software tool in our repository https://github.com/immunomind/immunarch Can you provide an example of the output file of CATT please?

Immunarch issue to track the parser development: immunomind/immunarch#90

Thank you so much!

Best regards,
Vadim

Hi,

I encountered this error when running CATT for the first time:

However, a quick Google search revealed an easy solution. I only had to change line 587 of catt.jl:

tab = CSV.read("$PATH2CATT/prob.csv",DataFrame)

Hello,

I'm unable to run catt tool. I've set the samtools and bwa paths correctly but the error persists
[ Info: 2024-04-19 00:57:59] Program start
[ Info: 2024-04-19 00:57:59] Handing Single-end sample: testSample.fq
[ Info: 2024-04-19 00:57:59] Aligning
ERROR: LoadError: TaskFailedException

nested task error: failed processes:
  Process(`bwa mem -v 0 -SP -t 4 -k 10 -A 1 -B 2 -L 0 -T 12 /project/ypatel_840/pjaiswal/TCR_project/cat/CATT/resource/TR/hs/TRB/TRBJ-gai3-DNA.fa testSample.fq`, ProcessExited(1)) [1]
  Process(`samtools sort -O SAM -t AS -l 0 -@ 4`, ProcessExited(1)) [1]
  Process(`samtools view -F 2308`, ProcessExited(1)) [1]
  Process(`samtools view -h -T /project/ypatel_840/pjaiswal/TCR_project/cat/CATT/resource/TR/hs/TRB/TRBJ-gai3-DNA.fa`, ProcessExited(1)) [1]

Stacktrace:
 [1] pipeline_error(procs::Base.ProcessChain)
   @ Base ./process.jl:578
 [2] run(::Base.CmdRedirect; wait::Bool)
   @ Base ./process.jl:480
 [3] run
   @ ./process.jl:477 [inlined]
 [4] map2align(input_file::String, ref::String, fasta_flag::Cmd, prefix::String, threads::Int64, score::Int64)
   @ Main /project/ypatel_840/pjaiswal/TCR_project/cat/CATT/catt.jl:44
 [5] (::var"#94#96"{Dict{String, Any}, Vector{Any}, Cmd, String, Int64})()
   @ Main ./task.jl:514

Stacktrace:
[1] sync_end(c::Channel{Any})
@ Base ./task.jl:445
[2] macro expansion
@ ./task.jl:477 [inlined]
[3] input_convert(args::Dict{String, Any}, input_file::String; input_file2::Nothing)
@ Main /project/ypatel_840/pjaiswal/TCR_project/cat/CATT/catt.jl:144
[4] input_convert(args::Dict{String, Any}, input_file::String)
@ Main /project/ypatel_840/pjaiswal/TCR_project/cat/CATT/catt.jl:135
[5] proc(args::Dict{String, Any})
@ Main /project/ypatel_840/pjaiswal/TCR_project/cat/CATT/catt.jl:768
[6] top-level scope
@ /project/ypatel_840/pjaiswal/TCR_project/cat/CATT/catt.jl:786
in expression starting at /project/ypatel_840/pjaiswal/TCR_project/cat/CATT/catt.jl:785

Could you please help me how to resolve this?

Hello,
I want to run CATT in the computer cluster, because I am not familiar with Julia, so I have chosen to run it in Docker, however, the cluster doesn't support Docker, but supports Singularity. After build image with command "singularity build CATT.sif docker://guobioinfolab/catt:latest”，I use the command " /path/to/CATT.sif catt -h" to test whether it works, as so far, everything is OK, but when I try to run test example "/path/to/CATT.sif catt -f testSample.fq -o testSampleOutput", it raise the error "
Traceback (most recent call last):
File "/usr/bin/catt", line 48, in
with open("/home/feifei/config.jl", "w") as handle:
IOError: [Errno 30] Read-only file system: '/home/feifei/config.jl' "
I try to change the file permission in the image, it is failed.
Could you give me some advice to address this problem?
Thanks!

System : CentOS Linux release 7.7.1908 (Core)
Singularity version: 3.2.0

Hi,

Very eager to try this out! Apologies in advance; I'm a beginner.

I've managed to get the docker image running and can successfully run the testSample.fq

I'm now trying to run my own data which is paired end and am getting a load error.

Here's what I'm running:

docker run -it --rm -v $PWD:/output -w /output -u $UID guobioinfolab/catt \

catt --f1 /Users/XXX/Documents/CATT/PT1_S5_L001_R1_001.fastq --f2 /Users/XXX/Documents/CATT/PT1_S5_L001_R2_001.fastq -o PT1

Here's the output:

[ Info: 2020-06-30 23:13:01] Program start
[ Info: 2020-06-30 23:13:02] Handing Paired-end sample: /Users/XXX/Documents/CATT/PT1_S5_L001_R1_001.fastq
[ Info: 2020-06-30 23:13:02] Aligning
ERROR: LoadError: failed process: Process(/home/feifei/bwa-0.7.17/bwa mem -v 1 -t 4 -k 8 -A 1 -B 2 -L 0 -T 12 /home/feifei/resource/TR/hs/TRB/TRBV-gai6-DNA.fa /Users/XXX/Documents/CATT/PT1_S5_L001_R1_001.fastq, ProcessExited(1)) [1]
error(::String, ::Base.Process, ::String, ::Int64, ::String) at ./error.jl:42
pipeline_error at ./process.jl:785 [inlined]
pipeline_error(::Base.ProcessChain) at ./process.jl:798
#run#515(::Bool, ::Function, ::Base.CmdRedirect) at ./process.jl:726
run at ./process.jl:724 [inlined]
map2align(::String, ::String, ::Cmd, ::String, ::Int64, ::Int64) at /home/feifei/catt.jl:39
(::getfield(Main, Symbol("##99#101")){Dict{String,Any}})() at ./task.jl:259

...and 3 more exception(s).

Stacktrace:
[1] sync_end(::Array{Any,1}) at ./task.jl:226
[2] #input_convert#98(::String, ::Function, ::Dict{String,Any}, ::String) at ./task.jl:245
[3] (::getfield(Main, Symbol("#kw##input_convert")))(::NamedTuple{(:input_file2,),Tuple{String}}, ::typeof(input_convert), ::Dict{String,Any}, ::String) at ./none:0
[4] proc(::Dict{String,Any}) at /home/feifei/catt.jl:761
[5] top-level scope at /home/feifei/catt.jl:823
[6] include at ./boot.jl:326 [inlined]
[7] include_relative(::Module, ::String) at ./loading.jl:1038
[8] include(::Module, ::String) at ./sysimg.jl:29
[9] exec_options(::Base.JLOptions) at ./client.jl:267
[10] _start() at ./client.jl:436
in expression starting at /home/feifei/catt.jl:822

Any help would be greatly appreciated!

Hi, congratulations for the project, great job.
I have some questions regarding the analysis of Chromium 10X format data.

From the documentations:
catt --tenX --f1 R1 --f2 R2 -o outputName

Chromium 10X output consists of 6 FASTQ files split into two sequencing lanes L001 and L002, each with 2 reads of R1 (barcodes), R2 (cDNA sequences), I1 (illumina lane info); are catt R1 and R2 argument operators for the script or shall I substitute them with the 2 + 2 *.fastq.gz file names? If this is the case, what syntax please? I have tentatively tried to run (from the folder where I have the 6 FASTQ files)

catt --tenX --f1 R1 --f2 R2 -o outputName

and also

catt --tenX --f1 sample_L001_R1_001.fastq.gz --f2 sample_L001_R2_001.fastq.gz -o outputName

but in both cases I have the following error message:

Program start
ERROR: LoadError: MethodError: no method matching split(::Array{String,1}, ::Char)
Closest candidates are:
split(::T, ::AbstractChar; limit, keepempty) where T<:AbstractString at strings/util.jl:387
split(::T, ::Any; limit, keepempty) where T<:AbstractString at strings/util.jl:379
split(::CategoricalValue{String,R} where R<:Integer, ::Any; kwargs...) at deprecated.jl:70
Stacktrace:
[1] split_10X(::Array{String,1}, ::Array{String,1}) at ./CATT/catt.jl:634
[2] proc(::Dict{String,Any}) at ./CATT/catt.jl:721
[3] top-level scope at ./CATT/catt.jl:806
[4] include(::Function, ::Module, ::String) at ./Base.jl:380
[5] include(::Module, ::String) at ./Base.jl:368
[6] exec_options(::Base.JLOptions) at ./client.jl:296
[7] _start() at ./client.jl:506
in expression starting at ./CATT/catt.jl:805

Any suggestions to resolve this issue please?
Thank you in advance for your help!

Sara

We are stucked in the first attempt to run the sample file in CATT.
Getting this error message repeatedly---------_"ERROR: LoadError: ArgumentError: Distributed not found in path
while loading /home/hem/Documents/sra_study/CATT/CATT/catt.jl, in expression starting on line 8"
the command we submitted was the same as described in CATT github tutorial----"catt -f testSample.fq -o output -t 2"

I am experiencing a problem with the git-installed CATT resource folder. How to fix it ?

$ catt -f testSample.fq -o testSampleOutput -t 2
[bwa_index] Pack FASTA... 0.00 sec
[bwa_index] Construct BWT for the packed sequence...
[bwa_index] 0.01 seconds elapse.
[bwa_index] Update BWT... 0.00 sec
[bwa_index] Pack forward-only FASTA... 0.00 sec
[bwa_index] Construct SA from BWT and Occ... 0.00 sec
[main] Version: 0.7.17-r1188
[main] CMD: bwa index ./resource/TR/hs/TRBV.fa
[main] Real time: 0.322 sec; CPU: 0.015 sec
[bwa_index] Pack FASTA... 0.00 sec
[bwa_index] Construct BWT for the packed sequence...
[bwa_index] 0.00 seconds elapse.
[bwa_index] Update BWT... 0.00 sec
[bwa_index] Pack forward-only FASTA... 0.00 sec
[bwa_index] Construct SA from BWT and Occ... 0.00 sec
[main] Version: 0.7.17-r1188
[main] CMD: bwa index ./resource/TR/hs/TRBJ.fa
[main] Real time: 0.305 sec; CPU: 0.004 sec
[ Info: 2023-09-26 15:41:18] Program start
[ Info: 2023-09-26 15:41:19] Handing Single-end sample: testSample.fq
[ Info: 2023-09-26 15:41:19] Aligning
ERROR: LoadError: TaskFailedException

nested task error: failed processes:
  Process(`/path/to/samtools sort -O SAM -t AS -l 0 -@ 4`, ProcessSignaled(13)) [0]
  Process(`/path/to/samtools view -F 2308`, ProcessSignaled(13)) [0]
  Process(`tail -r`, ProcessExited(1)) [1]
  Process(`/path/to/samtools view -h -T /path/to/CATT/resource/TR/hs/TRB/TRBV-gai6-DNA.fa`, ProcessExited(1)) [1]

Stacktrace:
 [1] pipeline_error(procs::Base.ProcessChain)
   @ Base ./process.jl:578
 [2] run(::Base.CmdRedirect; wait::Bool)
   @ Base ./process.jl:480
 [3] run
   @ ./process.jl:477 [inlined]
 [4] map2align(input_file::String, ref::String, fasta_flag::Cmd, prefix::String, threads::Int64, score::Int64)
   @ Main /path/to/CATT/catt.jl:43
 [5] (::var"#93#95"{Dict{String, Any}, Vector{Any}, Cmd, String, Int64})()
   @ Main ./task.jl:514

...and 1 more exception.

Stacktrace:
[1] sync_end(c::Channel{Any})
@ Base ./task.jl:445
[2] macro expansion
@ ./task.jl:477 [inlined]
[3] input_convert(args::Dict{String, Any}, input_file::String; input_file2::Nothing)
@ Main /path/to/CATT/catt.jl:143
[4] input_convert(args::Dict{String, Any}, input_file::String)
@ Main /path/to/CATT/catt.jl:134
[5] proc(args::Dict{String, Any})
@ Main /path/to/CATT/catt.jl:767
[6] top-level scope
@ /path/to/CATT/catt.jl:785
in expression starting at /path/to/CATT/catt.jl:784

Hi,
I was wondering whether you are planning to support different genome builds in the future? I would be specifically interested in hg38/GRCh38.
Thanks!

Hello,

I have pulled the Docker Image and try to use the tool to characterize T cell receptor sequences in single-cell RNAseq data. It works fine on human data but for mouse samples I’m getting this Error message:

[ Info: 2021-04-23 10:25:40] Program start
[ Info: 2021-04-23 10:25:41] Handing Paired-end sample: A1-MAA000510-3_8_M-1-1_R1_001.fastq
[ Info: 2021-04-23 10:25:42] Aligning
ERROR: LoadError: failed processes:
Process(/home/feifei/bwa-0.7.17/bwa mem -v 1 -t 4 -k 8 -A 1 -B 2 -L 0 -T 12 /home/feifei/resource/TR/ms/TRBV-CDR3.fa A1-MAA000510-3_8_M-1-1_R1_001.fastq, ProcessExited(1)) [1]
Process(/home/feifei/samtools-1.10/samtools view -h -F 2308, ProcessExited(1)) [1]
error(::String) at ./error.jl:33
pipeline_error(::Base.ProcessChain) at ./process.jl:803
#run#515(::Bool, ::Function, ::Base.CmdRedirect) at ./process.jl:726
run at ./process.jl:724 [inlined]
map2align(::String, ::String, ::Cmd, ::String, ::Int64, ::Int64) at /home/feifei/catt.jl:39
(::getfield(Main, Symbol("##99#101")){Dict{String,Any}})() at ./task.jl:259

...and 3 more exception(s).

Stacktrace:
[1] sync_end(::Array{Any,1}) at ./task.jl:226
[2] #input_convert#98(::String, ::Function, ::Dict{String,Any}, ::String) at ./task.jl:245
[3] (::getfield(Main, Symbol("#kw##input_convert")))(::NamedTuple{(:input_file2,),Tuple{String}}, ::typeof(input_convert), ::Dict{String,Any}, ::String) at ./none:0
[4] proc(::Dict{String,Any}) at /home/feifei/catt.jl:761
[5] top-level scope at /home/feifei/catt.jl:823
[6] include at ./boot.jl:326 [inlined]
[7] include_relative(::Module, ::String) at ./loading.jl:1038
[8] include(::Module, ::String) at ./sysimg.jl:29
[9] exec_options(::Base.JLOptions) at ./client.jl:267
[10] _start() at ./client.jl:436
in expression starting at /home/feifei/catt.jl:822

The command I use is:
catt --sc --species ms --f1 inputFile1 --f2 inputFile2 -o outputName

Any suggestions to resolve this issue?
Thank you in advance for your help!

Hi,

Possibly the same as to Dharamendra's question: Is it similarly straightforward to add support for human gamma delta TCRs?

Best regards,
Don

I got an error in the first test to run your sample file in CATT.

WARNING: both Threads and Distributed export "@Spawn"; uses of it in module Main must be qualified
ERROR: LoadError: UndefVarError: @Spawn not defined
in expression starting at /scratch1/vahed/data/tools/CATT/catt.jl:175
in expression starting at /scratch1/vahed/data/tools/CATT/catt.jl:144

Hi,

I tried running CATT on the testSample.fq; and I am getting the following error:

catt -f testSample.fq -o testSampleOutput -t 4
[ Info: 2020-08-05 19:19:42] Program start
[ Info: 2020-08-05 19:19:42] Handing Single-end sample: testSample.fq
[ Info: 2020-08-05 19:19:42] Aligning
[ Info: 2020-08-05 19:19:50] Reading aligned results
[ Info: 2020-08-05 19:20:02] Processing both mapped reads
[ Info: 2020-08-05 19:20:03] Sequence error rate: 0.0076
[ Info: 2020-08-05 19:20:03] Adaptive kmer length 23
[ Info: 2020-08-05 19:20:03] Search Range: 1326
[ Info: 2020-08-05 19:20:03] Searching from full candidate reads
[ Info: 2020-08-05 19:20:03] Directly found 675
[ Info: 2020-08-05 19:20:03] Break partital reads into kmer
[ Info: 2020-08-05 19:20:03] There are 651 reads left
ERROR: LoadError: TaskFailedException:
UndefVarError: x not defined
Stacktrace:
[1] Composition(::BioSequences.EveryMerIterator{Mer{DNAAlphabet{2},23},LongSequence{DNAAlphabet{4}}}) at /gpfs/home/nadorb01/.julia/packages/BioSequences/k4j4J/src/composition.jl:80
[2] composition(::BioSequences.EveryMerIterator{Mer{DNAAlphabet{2},23},LongSequence{DNAAlphabet{4}}}) at /gpfs/home/nadorb01/.julia/packages/BioSequences/k4j4J/src/composition.jl:92
[3] (::var"#143#144"{Int64})(::Myread) at ./none:0
[4] iterate at ./generator.jl:47 [inlined]
[5] mapfoldl_impl(::Function, ::Function, ::NamedTuple{(),Tuple{}}, ::Base.Generator{Array{Myread,1},var"#143#144"{Int64}}) at ./reduce.jl:55
[6] depcature at ./reduce.jl:72 [inlined]
[7] macro expansion at /home/common_scripts/CATT/catt.jl:419 [inlined]
[8] (::var"#94#threadsfor_fun#149"{Array{Myread,1},Int64,Array{Int64,1},Array{Composition{Mer{DNAAlphabet{2},23}},1},UnitRange{Int64}})(::Bool) at ./threadingconstructs.jl:61
[9] (::var"#94#threadsfor_fun#149"{Array{Myread,1},Int64,Array{Int64,1},Array{Composition{Mer{DNAAlphabet{2},23}},1},UnitRange{Int64}})() at ./threadingconstructs.jl:28
Stacktrace:
[1] wait(::Task) at ./task.jl:251
[2] macro expansion at ./threadingconstructs.jl:69 [inlined]
[3] bbk(::Array{Myread,1}, ::Int64) at /home/common_scripts/CATT/catt.jl:418
[4] catt(::Array{Myread,1}, ::Array{Myread,1}, ::String, ::Dict{String,Any}, ::String) at /home/common_scripts/CATT/catt.jl:469
[5] mainflow(::Dict{String,Any}, ::Array{Any,1}, ::Array{Any,1}, ::String, ::String) at /home/common_scripts/CATT/catt.jl:682
[6] proc(::Dict{String,Any}) at /home/common_scripts/CATT/catt.jl:779
[7] top-level scope at /home/common_scripts/CATT/catt.jl:806
[8] include at ./boot.jl:328 [inlined]
[9] include_relative(::Module, ::String) at ./loading.jl:1105
[10] include(::Module, ::String) at ./Base.jl:31
[11] exec_options(::Base.JLOptions) at ./client.jl:287
[12] _start() at ./client.jl:460
in expression starting at /home/common_scripts/CATT/catt.jl:805

Unfortunately, our cluster does not support Docker. Any idea what the problem might be?
I am using:
python 3.7.1
julia> Pkg.status()
Status ~/.julia/environments/v1.3/Project.toml
[00701ae9] BioAlignments v2.0.0
[7e6ae17a] BioSequences v2.0.5
[336ed68f] CSV v0.7.7
[a93c6f00] DataFrames v0.21.6
[864edb3b] DataStructures v0.17.20
[c2308a5c] FASTX v1.1.3
[92fee26a] GZip v0.5.1
[d759349c] XAM v0.2.6
[ade2ca70] Dates
[8ba89e20] Distributed
[9a3f8284] Random
[cf7118a7] UUIDs

Thanks!

Hi,
I found some weird behaviour when running paired-end data.

To test some stuff, I created some simulated datasets where I know all the parameters like repertoire size, size of each clonotype, V gene, J gene etc.
I created the fastq's as paired-end seq files
and ran catt with the following command catt --f1 test_R1.fastq --f2 test_R2.fastq -o test_out -t 20.

The unintended behaviour I experienced can nicely be seen in one of my samples with a repertoire of one clonotype with 10.000 clones.
Catt returns 3 clones with exactly equal NNseq:
AAseq,NNseq,Prob,Vregion,Jregion,Dregion,Frequency CSARGDRGLSYNEQFF,TGCAGTGCTCGGGGGGACAGGGGGCTATCCTACAATGAGCAGTTCTTC,0.00016,TRBV20-1*02,TRBJ2-1*01,TRBD1*01,6727 CSARGDRGLSYNEQFF,TGCAGTGCTCGGGGGGACAGGGGGCTATCCTACAATGAGCAGTTCTTC,0.00016,TRBV20-1*06,TRBJ2-1*01,TRBD1*01,6727 CSARGDRGLSYNEQFF,TGCAGTGCTCGGGGGGACAGGGGGCTATCCTACAATGAGCAGTTCTTC,0.00016,TRBV20-1*03,TRBJ2-1*01,TRBD1*01,6546

When combining the "different" clonotypes into one the frequencies sum up to 20.000 clones instead of 10.000.
So, it seems like catt is counting each clone twice

I thus merged the paired end files to a single file using pear and repeated the analysis.
This returned the same results as the paired-end run, only the frequencies are different.
AAseq,NNseq,Prob,Vregion,Jregion,Dregion,Frequency CSARGDRGLSYNEQFF,TGCAGTGCTCGGGGGGACAGGGGGCTATCCTACAATGAGCAGTTCTTC,0.00016,TRBV20-1*06,TRBJ2-1*01,TRBD1*01,3379 CSARGDRGLSYNEQFF,TGCAGTGCTCGGGGGGACAGGGGGCTATCCTACAATGAGCAGTTCTTC,0.00016,TRBV20-1*02,TRBJ2-1*01,TRBD1*01,3348 CSARGDRGLSYNEQFF,TGCAGTGCTCGGGGGGACAGGGGGCTATCCTACAATGAGCAGTTCTTC,0.00016,TRBV20-1*03,TRBJ2-1*01,TRBD1*01,3273
For the merged "single-end" files the clones sum up to the expected 10.000.
What confuses me a little though that the counts aren't exactly half of the ones in the paired-end run

I guess that there must be some issue when counting the frequency for the paired-end samples.

Would be awesome if you could have a look!
Thanks!

Hello,

I'm getting this issue for some of my Fastq files.

[ Info: 2020-08-02 07:06:27] Program start
[ Info: 2020-08-02 07:06:28] Handing Paired-end sample: /projects/b1042/MeeksLab/abacus/6/62C51828A4DD56C3C570218C79F140DB_1_val_
1.fq.gz
[ Info: 2020-08-02 07:06:28] Aligning
[ Info: 2020-08-02 07:35:48] Reading aligned results
ERROR: LoadError: BioAlignments.SAM.Reader file format error on line 1 ~>"D00760:3"
Stacktrace:
[1] error(::Type, ::String, ::Int64, ::String, ::String) at ./error.jl:42
[2] _read!(::BioAlignments.SAM.Reader, ::BioCore.Ragel.State{BufferedStreams.BufferedInputStream{IOStream}}, ::BioAlignments.SAM.Record) at /home/kam9898/.julia/packages/BioCore/YBJvb/src/ReaderHelper.jl:164
[3] read!(::BioAlignments.SAM.Reader, ::BioAlignments.SAM.Record) at /home/kam9898/.julia/packages/BioCore/YBJvb/src/ReaderHelper.jl:134
[4] tryread!(::BioAlignments.SAM.Reader, ::BioAlignments.SAM.Record) at /home/kam9898/.julia/packages/BioCore/YBJvb/src/IO.jl:73
[5] iterate at /home/kam9898/.julia/packages/BioCore/YBJvb/src/IO.jl:84 [inlined]
[6] read_alignrs(::Dict{String,Any}, ::Array{Any,1}, ::Array{Any,1}, ::String) at /projects/b1042/MeeksLab/catt/CATT/catt.jl:230
[7] mainflow(::Dict{String,Any}, ::Array{Any,1}, ::Array{Any,1}, ::String, ::String) at /projects/b1042/MeeksLab/catt/CATT/catt.jl:700
[8] proc(::Dict{String,Any}) at /projects/b1042/MeeksLab/catt/CATT/catt.jl:764
[9] top-level scope at /projects/b1042/MeeksLab/catt/CATT/catt.jl:825
[10] include at ./boot.jl:328 [inlined]
[11] include_relative(::Module, ::String) at ./loading.jl:1105
[12] include(::Module, ::String) at ./Base.jl:31
[13] exec_options(::Base.JLOptions) at ./client.jl:287
[14] _start() at ./client.jl:460
in expression starting at /projects/b1042/MeeksLab/catt/CATT/catt.jl:824

This is the command I used:
for prefix in $(ls /projects/b1042/MeeksLab/abacus/6/62C*gz | rev | cut -c 14- | rev | uniq)
do
/projects/b1042/MeeksLab/catt/CATT/./catt --f1 ${prefix}1_val_1.fq.gz --f2 ${prefix}2_val_2.fq.gz -o $prefix -t 4
done

可否方便提供一下CATT的docker file? 国内从dockerhub上拉取镜像非常慢，我考虑拿到dockerfile后自己在阿里云上面制作。或者：将dockerhub上的镜像同步一份到阿里云上，方便国内用户使用