Git Product home page Git Product logo

vidhop's Introduction

VIDHOP

VIDHOP is a virus host predicting tool. Its able to predict influenza A virus, rabies lyssavirus and rotavirus A. Furthermore the user can train its own models for other viruses and use them with VIDHOP. This is the tool descripted in the original paper, for the supplementary and training data look here.

Install:

We recommend to use linux and miniconda for the enviroment management

  1. Download and install Conda.

  2. Download the enviroment yml file

  3. Activate the Conda environment. You will need to activate the Conda environment in each terminal in which you want to use VIDHOP.

    conda env create -f vidhop.yml
  4. Activate the Conda environment. You will need to activate the Conda environment in each terminal in which you want to use vidop.

    conda activate vidhop

How to use:

VIDHOP has three different commands each with its own parameter set.

make_dataset: create the data structure needed for training

training: train a model on your training files generated with make_dataset

predict: predict the host of the viral sequence given

Use vidhop --help to see this summary of all three methods.

Likely you'll mainly use predict, see below various examples:

examples for vidhop predict:

vidhop predict -i /home/user/fasta/influenza.fna -v influ

present only hosts which reach a threshold of 0.2

vidhop predict -i /home/user/fasta/influenza.fna -v influ -t 0.2

if you want the output in a file

vidhop predict -i /home/user/fasta/influenza.fna -v influ -o /home/user/vidhop_result.txt

use multiple fasta-files in directory

vidhop predict -i /home/user/fasta/ -v rabies

use multiple fasta-files in directory and only present top 3 host predictions per sequence

vidhop predict -i /home/user/fasta/ -v rabies -n_hosts

Use your own trained models generated with vidhop training. You need to specify the path to the .model file you want to use. It's located in the output directory of vidhop training. You can choose between the model with the lowest loss and the model with the highest accuracy while training.

vidhop predict -v /home/user/out_training/model_best_acc_testname.model -i /home/user/fasta/my_favourite_virus.fna

Options:

command what it does
-i, --input either raw sequences or path to fasta file or directory with multiple files. [required]
-v, --virus select virus species (influ, rabies, rota) [required]
-o, --outpath path where to save the output
-n, --n_hosts show only -n most likely hosts
-t, --thresh show only hosts with higher likeliness then --thresh
--auto_filter automatically filters output to present most relevant host
--help show this message and exit.
--version show version number from vidhop

Example output and what it means:

per autofilter selected host of interest
Anas crecca: 0.3680844306945801
Anser fabalis: 0.22696886956691742

all hosts
Anas crecca: 0.3680844306945801
Anser fabalis: 0.22696886956691742
Cairina moschata: 0.14039446413516998
Anas acuta: 0.0806809589266777
Anas platyrhynchos: 0.0766301080584526
Anas clypeata: 0.06576793640851974
Anas rubripes: 0.01164703257381916
Mareca strepera: 0.009029239416122437
Gallus gallus: 0.005793101154267788
Anas discors: 0.0032478864304721355
Tadorna ferruginea: 0.0021137858275324106
Struthio camelus: 0.0017334294971078634
Chroicocephalus ridibundus: 0.001212031696923077
Anas carolinensis: 0.0011747170938178897
Cygnus columbianus: 0.0009851191425696015

The output is a list of potential hosts sorted by probability. For example an value of 0.368 represents a likelihood of 36.8% that this is the correct host, according to VIDHOP. The autofilter selects hosts the most promissing candidates.

Train and use your own model:

If you like to skip ahead see toy-example.

Train your own model for other viruses than the provided ones (influenza A virus, rabies lyssavirus and rotavirus A) is simple. The workflow consists of three steps:

  1. vidhop make_dataset

  2. vidhop training

  3. vidhop predict

vidhop make_dataset

To generate the data sets needed for training you need to provide two input files.

  1. A sequence file containing in each line a DNA sequence.

  2. A host file containing the name of the host corresponding to the DNA sequence at identical line number in the sequence file.

example input

sequences.txt hosts.txt
AAATTT human
CGTATA swine
CGTATT swine

examples for vidhop make_dataset:

Example: set input and output parameter

vidhop make_dataset -x /home/user/input/seq.txt -y /home/user/input/host.txt -o /home/user/trainingdata/

change the validation set size and provide datastructure for repeated undersampling

vidhop make_dataset -x /home/user/input/seq.txt -y /home/user/input/host.txt -v 0.1 -r
command what it does
-x, --sequences Path to the file containing sequence list [required].
-y, --hosts Path to the file containing corresponding host list [required].
-o, --outpath Path where to save the output.
-n, --n_hosts Show only -n most likely hosts.
-v, --val_split_size Select the portion of the data which is used for the validation set.
-t, --test_split_size Select the portion of the data which is used for the test set.
-r, --repeated_undersampling Generate training files needed for reapeted undersampling while training.
--help Show this message and exit.

vidhop training

The training of a model is done by providing the output directory of vidhop make_dataset as the input of vidhop training. The user can specify various parameter which change the architecture, training duration, input handling and further more. For further details to different parameters like --extention_variant or --repeated_undersampling see the paper, virus host prediction with deep learning.

examples for vidhop training:

set input output and name of the model

vidhop training -i /home/user/trainingdata/ -o /home/user/model/ --name test

use the LSTM archtecture and the extention variant random repeat

vidhop training -i /home/user/trainingdata/ --architecture 0 --extention_variant 2

use repeated undersampling for training, note that for this the dataset must have been created with repeated undersampling enabled

vidhop training -i /home/user/trainingdata/ -r

train the model for 40 epochs, stop training if for 2 epochs the accuracy did not increase

vidhop train_new_model -i /home/user/trainingdata/ --epochs 40 --early_stopping
command what it does
-i, --inpath Path to the dir with training files, generated with make_dataset [required].
-o, --outpath Path where to save the output.
-n, --name Suffix added to output file names.
-e, --epochs Maximum number of epochs used for training the model.
-a, --architecture Select architecture (0:LSTM, 1:CNN+LSTM).
-v, --extention_variant Select extension variant (0:Normal repeat, 1:Normal repeat with gaps, 2:Random repeat, 3:Random repeat with gaps, 4:Append gaps, 5:Smallest, 6:Online).
-s, --early_stopping Stop training when model accuracy did not improve over time, patience 5% of max epochs.
-r, --repeated_undersampling Use repeated undersampling while training, to be usable the training files must be generated with make_datasets and activated reapeted undersampling parameter.
--help Show this message and exit.

toy-example

Download the test files X.txt (containing all sequences) und Y.txt (containing all corresponding hosts).

wget https://github.com/flomock/vidhop/blob/master/X.txt
wget https://github.com/flomock/vidhop/blob/master/Y.txt

Now we prepare the dataset. As an example we define the size of the validation-set to 10% and the test-set to 20% of the full dataset. Note that the all data sets will be balanced according to their host classes. To use all samples, even from an unbalanced dataset, without biasing towards the most common host class, use the --repeated_undersampling parameter. This effects the samples used while training. The validation and test sets will be unchanged.

vidhop make_dataset -x X.txt -y Y.txt -r -o ./make_dataset_out -v 0.1 -t 0.2

If a host in your dataset is bellow the recommended minimal count of 100 samples, vidhop make_dataset will return a warning. The expected console output:

warning number samples for host Artibeus lituratus low, only 90 samples
warning number samples for host Lasiurus borealis low, only 96 samples
warning number samples for host Cerdocyon thous low, only 82 samples

Now we train a model using the standard parameter. As input we provide the output directory of vidhop make_dataset. Furthermore we name our model "test_standard". To limit training time we use -e to limit the number of epochs to two.

vidhop training -i ./make_dataset_out -n test_standard -e 2 -o ./trained_models

The output printed to the console provides information about the input provided, the current architecture used, the current status of the training. When the actual training is completed two models are saved. One model which represents the model with the lowest loss during training and one model with the highest accuracy during training, both calculated on the validation set. After training and saving these models each model is tested on the test dataset. The results are printed in the console.

Now we are able to predict the host of new sequences. For this we use vidhop predict. You can provide either a fasta file for prediction or a DNA sequence directly. Here we use an DNA sequence. Furthermore we define a the virus to use the path to one of our trained models, either the one with the lowest loss or the one with the highest accuracy while training. If you are not sure which of the both models to use, we experienced the best results working with the model with the highest accuracy.

vidhop predict -v ./trained_models/model_best_acc_test_standard.model -o ./predictions/first_test.txt -i AAATGCTCTGAATTCGACATGAAAAAAACAAGCAACACCACTGATAAGATGAACTTTCTACGCAAGAAATGCTCTGAATTCGACATGAAAAAAACAAGCAACACCACTGATAAGATGAACTTTCTACGCAAG

This results in a prediction similar to:

>user command line input
all hosts
Lasiurus borealis: 0.061880290508270264
Procyon lotor: 0.06131688505411148
Desmodus rotundus: 0.06110725179314613
Mephitis mephitis: 0.060785286128520966
Vulpes vulpes: 0.060404110699892044
Capra hircus: 0.06007476523518562
Vulpes lagopus: 0.059015918523073196
Artibeus lituratus: 0.0590040422976017
Tadarida brasiliensis: 0.05887320265173912
Nyctereutes procyonoides: 0.0584951676428318
Eptesicus fuscus: 0.05815460532903671
Felis catus: 0.05793345347046852
Equus caballus: 0.0575258694589138
Homo sapiens: 0.05704779922962189
Bos taurus: 0.05660048499703407
Canis lupus: 0.056392643600702286
Cerdocyon thous: 0.05538821220397949

(note that the input sequence is more or less random, so don't expect a very meaningful prediction)

Thanks for using VIDHOP.



Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License.

vidhop's People

Contributors

flomock avatar marielataretu avatar

Stargazers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

Watchers

 avatar  avatar  avatar

vidhop's Issues

Role of CNN in arhcitecture

In the paper, it notes "The second evaluated architecture uses two layers of convolutional neural networks (CNN) nodes,
followed by two bidirectional LSTM layers and two dense layers. In the following we will refer
to this as the CNN+LSTM architecture (see Figure 5b). Similar to the LSTM architecture, each
layer consists of 150 nodes with exception to the output layer. The idea behind this architecture
is that the CNN identifies important sequence parts (first layer), combines the short sequence
features to more complex patterns (second layer), which can then be put into context by the
LSTMs, which are able to remember previously seen patterns."

May I please know how you are able to determine that the first layer identifies the important sequences and the second combines short seqs into more complex patterns?

0.95 quantile length of all sequences

Hi. I came across this paper, and I would like to congratulate you for such inspiring work. However, I have a small doubt which I would appreciate if you could kindly clarify. In the input preparation part, it is written that "To achieve this, the length of the sequences was limited to the 0.95 quantiles of all sequence lengths by truncating the first positions or in the case of shorter sequences by extension". Could you kindly explain what this means? Also, doesn't trimming affect the results of the same?

How to interpret results output?

Hi there,

It would be great if you could put a section on the github page explaining how to interpret the results.

For example:

per autofilter selected host of interest
Anas crecca: 0.3680844306945801
Anser fabalis: 0.22696886956691742

all hosts
Anas crecca: 0.3680844306945801
Anser fabalis: 0.22696886956691742
Cairina moschata: 0.14039446413516998
Anas acuta: 0.0806809589266777
Anas platyrhynchos: 0.0766301080584526
Anas clypeata: 0.06576793640851974
Anas rubripes: 0.01164703257381916
Mareca strepera: 0.009029239416122437
Gallus gallus: 0.005793101154267788
Anas discors: 0.0032478864304721355
Tadorna ferruginea: 0.0021137858275324106
Struthio camelus: 0.0017334294971078634
Chroicocephalus ridibundus: 0.001212031696923077
Anas carolinensis: 0.0011747170938178897
Cygnus columbianus: 0.0009851191425696015
Meleagris gallopavo: 0.0009607739630155265
Cygnus olor: 0.000805351126473397
Anser albifrons: 0.0007613449706695974
Sibirionetta formosa: 0.0007183055276982486
Arenaria interpres: 0.0004786542267538607
Mareca penelope: 0.0002570196520537138
Homo sapiens: 0.00010996501077897847
Calidris alba: 8.939660619944334e-05
Sus scrofa: 6.232935265870765e-05
Equus caballus: 4.330848969402723e-05
Anser indicus: 4.12571789638605e-05
Uria aalge: 3.911254680133425e-05
Mareca americana: 3.4262342524016276e-05
Larus glaucescens: 2.825823139573913e-05
Larus argentatus: 2.730808591877576e-05
Calidris canutus: 2.709106593101751e-05
Cygnus cygnus: 2.429257619951386e-05
Branta canadensis: 1.489372971263947e-05
Canis lupus: 1.0419771570013836e-05
Leucophaeus atricilla: 3.3015498956956435e-06
Calidris ruficollis: 3.182979355642601e-07

I am guessing the bigger the number the higher confidence? or is it percent likelihood?

Error during install: ResolvePackageNotFound

Hi,

I tried to install VIDHOP following your README.md

Unfortunately, when I try to execute "conda env create -f environment.yml"
I get the following error:

Collecting package metadata: done
Solving environment: failed

ResolvePackageNotFound:

  • hdf5==1.10.4=nompi_h11e915b_1105

my conda version is: 4.6.14
OS: Ubuntu
Python: 3.7

-Chris-

Where can I find datasets of your projects?

Hey, I was looking at your project and was trying to find the individual datasets used in the project. The one that you mentioned in paper, 40k for rotavirus. Are those open to access? If yes, Where can I find them. Thanks :)

I tried to look for it in the code, but I could only find hdf5 files.

UnsatisfiableError when installing

Hi there!

So when I try to install with your command 'conda install -c flomock -c anaconda vidhop=0.9' it says that there is an

'UnsatisfiableError: The following specifications were found to be incompatible with each other:

Output in format: Requested package -> Available versions'

I'm running Python3.7.6 as required (also tried it with Python3.7) for the Conda environment on Ubuntu and Mac.

Were there any changes?

Cheers!

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.