Comments (5)
The recombination regions are masked out with Ns.
On 16 Aug 2016 03:03, "cam09" [email protected] wrote:
Hi,
Is there a reason behind the filtered_polymorphic_sites.phylip file
containing 'N' bases in some of the sequences? The input file does not
contain any, so I'm unsure why N's are generated.Thanks,
Cam—
You are receiving this because you are subscribed to this thread.
Reply to this email directly, view it on GitHub
#178, or mute the
thread
https://github.com/notifications/unsubscribe-auth/AABeV2XZFBDOMeCQ9xpgBREdsCGgr31kks5qgRqGgaJpZM4Jk8_W
.
from gubbins.
Hi Andrew can you clarify please. In my alignment files the number of Ns
does not correlate to the number of SNPs identified in recombinant regions.
Also Ns in the alignment file are skewing the topology of the final tree
and introducing branches where there should be none.
Cheers
Brian
On Tue, Aug 16, 2016 at 4:53 PM, andrewjpage [email protected]
wrote:
The recombination regions are masked out with Ns.
On 16 Aug 2016 03:03, "cam09" [email protected] wrote:
Hi,
Is there a reason behind the filtered_polymorphic_sites.phylip file
containing 'N' bases in some of the sequences? The input file does not
contain any, so I'm unsure why N's are generated.Thanks,
Cam—
You are receiving this because you are subscribed to this thread.
Reply to this email directly, view it on GitHub
#178, or mute the
thread
<https://github.com/notifications/unsubscribe-auth/
AABeV2XZFBDOMeCQ9xpgBREdsCGgr31kks5qgRqGgaJpZM4Jk8_W>
.—
You are receiving this because you are subscribed to this thread.
Reply to this email directly, view it on GitHub
#178 (comment),
or mute the thread
https://github.com/notifications/unsubscribe-auth/AEZMMcsAssVhNQ9efNc-pw0i4UyRENpsks5qgV5xgaJpZM4Jk8_W
.
from gubbins.
Hi Brian,
The whole recombination region gets masked out with Ns, not just the SNPs. You mentioned that there are branches where you expect there to be none? Is the scale the same between your original tree and the output of gubbins (so were the branches always there but just compressed due to recombination)?
Unfortunately without looking at the data I cant really give you an answer.
Regards,
Andrew
from gubbins.
Hi Andrew,
Thanks for getting back. It is actually the opposite that we are seeing i.e
there are not enough masked regions in the filtered alignment file.
With regards to the branch it might best be explained with an example.
Based on the filtered alignment file StrainB has diverged directly from
strainA. However, in the tree we see strainA and B diverging from a common
ancestor. I can only concluded that Ns in the sequence of strainB are
introducing some uncertainty.
I am happy to send you the data if it would help
Brian
On Thu, Aug 18, 2016 at 1:10 AM, andrewjpage [email protected]
wrote:
Hi Brian,
The whole recombination region gets masked out with Ns, not just the SNPs.
You mentioned that there are branches where you expect there to be none? Is
the scale the same between your original tree and the output of gubbins (so
were the branches always there but just compressed due to recombination)?
Unfortunately without looking at the data I cant really give you an answer.
Regards,
Andrew—
You are receiving this because you commented.
Reply to this email directly, view it on GitHub
#178 (comment),
or mute the thread
https://github.com/notifications/unsubscribe-auth/AEZMMTfpuXOYn8g8KpM9Tl5bzoYTXeclks5qgyRRgaJpZM4Jk8_W
.
from gubbins.
Hi Andrew,
I have a similar question to Brian's. I found the N's in my phy file, which now I understand are masked recombinant regions. But what I don't understand is why do some strains have those N's but not others. If these are core SNPs, shouldn’t recombinant SNPs be masked in all strains?
E.g.
ACGGGACAGGGAGGTCTCACAATGCAA
ANNNNNNNNNNNNNNNNNNNNNNNNNA
ACGGGACAGGGAGGTCTCACAATGCAA
My concern is that the number of SNPs (shown at the header of phy file) is larger than that expected by 1000, which I think is accounting for those N's.
Thanks for your help.
from gubbins.
Related Issues (20)
- New ska version and masking HOT 5
- Gubbins input file error HOT 1
- File names with spaces cause error HOT 2
- Conda Gubbins 3.3.3 : Not able to install HOT 3
- RuntimeError: cannot cache function 'seq_to_int' HOT 5
- Conda Gubbins 3.3.4 : Not able to install HOT 11
- Unable to install gubbin HOT 6
- Multithreading not working on v3.3 HOT 1
- Can Gubbins be used on eukaryotic genomes? HOT 1
- Pyjar causing core dump HOT 7
- Latest Gubbins installs Gubbins 2.3.4 HOT 1
- Uninstalling gubbins 3.3.5 HOT 1
- Restart from iteration 4 stopping when entering main loop for Iteration 5 HOT 6
- Does Gubbins can be used for Mycobacterium tuberculosis? HOT 5
- Buffer overflow during model fitting HOT 6
- raxmlHPC-AVX2 error HOT 4
- REF and Reference do not match, is this expected? HOT 2
- Making a core SNP tree to go along with final.tre HOT 3
- How to restart a gubbins run using the --resume flag HOT 1
- Input File Error with Singularity/Apptainer
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from gubbins.