eternagame / eternajs Goto Github PK
View Code? Open in Web Editor NEWEterna game/RNA design interface
License: Other
eternajs's People
Contributors
![dependabot[bot] avatar](https://avatars.githubusercontent.com/in/29110?v=4 "dependabot[bot]")
Stargazers
Watchers
Forkers
natshah tolumide-ng pushingbhutons alexhalb curseoff appcoreopc zelirian sbutkovi lunarfawn eternavolunteerdeveternajs's Issues
Design browser view/copy fails when in freeze mode
Reported by Brourd
Same as #52, but with freeze mode
Molecule rotation fluidity
This seems to be an issue with Flash as well, but Brourd noted that the rotating molecule animation seems to be quite jerky - can this be improved?
Target Conditions Structure
In Puzzle and PuzzleManager, the "target conditions" are loosely typed, and includes some tight coupling, with parsing handled in multiple locations (they're being modified too, conflating things even further). Some additional classes/interfaces and enums (ie, for the type/is_aptamer_type/is_oligo_type stuff) need to be created.
js-polyfills is throwing a ton of errors
On loading a puzzle, I get something like this:
This traces back to js-polyfills/polyfills.js... which we shouldn't even be loading (we only import the keyboard script)? No issues due to this that I can see, but it would be great to get rid of the log spam.
Hotkeys do not work in MS Edge
Via Brourd
Errors in console don't show correctly in Firefox
Namely, you don't see the error text, ie you just get something like: Uncaught error value/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:1130054. We had discussed this before, but I can't remember - is there a reason why we use ErrorUtil.getErrString as opposed to just logging the error object? (https://github.com/EteRNAgame/EternaJS/blob/72037efea4b5b74f1851e15808908e4678e2c007/src/eterna/Eterna.ts#L30)
Images should be centered by default on the mission completion screen
Sample case: https://noflash.eternagame.org/game/puzzle/6502951/
This should theoretically just require a display: block; margin: auto;
That puzzle also shows evidence of newlines being handled differently, but I'm not sure if that's fixable (or how the Flash app got it to lay it out how it did at all)
Dotplot "bleed"
Via Brourd
In the dotplot, it appears that certain base pairing probabilities bleed through as an image into the frame and the area outside the dotplot. Sequence ( AAAAAAAGAGUGGAGCGGACCGGAAAGGAACGAGGACCGGUACGGCCGCCACUCGAGUGCUGCAGGAGUAGAUUAAAAAAAAAAA) used in this puzzle
Offcenter constraint text
Screenshot from Brourd
Hotkey Mapping Consolidation
Hotkey mappings should be in a central position of the code, as opposed to directly where it's used, so that it's easier to find what keys are in use where, and to pave the way for #45
"Go to home" button missing
Originally reported by Brourd
This thing
Multiple errors loading https://eternagame.org/game/puzzle/8787266/
Firefox console output:
PixiJS 4.8.2 - WebGL - http://www.pixijs.com/ index.js:279
GameClient baseURL=https://eternagame.org GameClient.ts:8:8
Error: WebGL warning: drawElements: This operation requires zeroing texture data. This is slow. SpriteRenderer.js:471
Initializing folding engines... EternaApp.ts:249:8
Loading fonts... Fonts.ts:17:8
Fonts loaded Fonts.ts:21:24
Folding engines intialized EternaApp.ts:257:16
Loading puzzle [nid=6892314, scriptid=-1...] PuzzleManager.ts:197:8
Loaded puzzle [name=[A]*[B]/[C]² DEC] PuzzleManager.ts:206:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
FullEval error RuntimeError: "index out of bounds"
420https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:193441:1322https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:148699:1179https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:78350:1386https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:161245:1374https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:158829:1263https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:128642:1dynCall_iiiii_1https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js line 1 > Function:4:12FullEvalhttps://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js line 1 > Function:10:10valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:401480valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:406003valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:407077valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:1035921valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:786233valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:177356valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:182181valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:180747emithttps://noflash.eternagame.org/eternajs/dist/prod/vendor.e5803fab441edb418460.js:74:21267updatehttps://noflash.eternagame.org/eternajs/dist/prod/vendor.e5803fab441edb418460.js:74:20288_tickhttps://noflash.eternagame.org/eternajs/dist/prod/vendor.e5803fab441edb418460.js:74:18471 NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
Running script 5751220... ExternalInterface.ts:190:8
Completed script 5751220 ExternalInterface.ts:161:16
Running script 5751220... ExternalInterface.ts:190:8
Completed script 5751220 ExternalInterface.ts:161:16
Running script 5751220... ExternalInterface.ts:190:8
Completed script 5751220 ExternalInterface.ts:161:16
done
nupack.js:8:784214
Uncaught error TypeError: this._seqStacks[this._stackLevel][e] is undefined Eterna.ts:37:8
[Show/hide message details.] TypeError: this._seqStacks[this._stackLevel][e] is undefined[Learn More] PoseEditMode.ts:1930:12
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
FullEval error RuntimeError: "index out of bounds"
420https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:194012:1322https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:148699:1179https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:78350:1386https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:161245:1374https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:158829:1263https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:128642:1dynCall_iiiii_1https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js line 1 > Function:4:12FullEvalhttps://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js line 1 > Function:10:10valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:401480valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:406003valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:407077valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:1035921valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:786233valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:177356valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:182181valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:180747emithttps://noflash.eternagame.org/eternajs/dist/prod/vendor.e5803fab441edb418460.js:74:21267updatehttps://noflash.eternagame.org/eternajs/dist/prod/vendor.e5803fab441edb418460.js:74:20288_tickhttps://noflash.eternagame.org/eternajs/dist/prod/vendor.e5803fab441edb418460.js:74:18471 NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
FullEval error RuntimeError: "index out of bounds"
420https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:193441:1322https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:148699:1179https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:78350:1386https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:161245:1374https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:158829:1263https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:128642:1dynCall_iiiii_1https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js line 1 > Function:4:12FullEvalhttps://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js line 1 > Function:10:10valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:401480valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:406003valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:407077valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:1035921valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:786233valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:177356valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:182181valuehttps://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:180747emithttps://noflash.eternagame.org/eternajs/dist/prod/vendor.e5803fab441edb418460.js:74:21267updatehttps://noflash.eternagame.org/eternajs/dist/prod/vendor.e5803fab441edb418460.js:74:20288_tickhttps://noflash.eternagame.org/eternajs/dist/prod/vendor.e5803fab441edb418460.js:74:18471 NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
done
nupack.js:8:784214
Too many ), not enough (! nupack.js:8:784214
FullEval error
Object { name: "ExitStatus", message: "Program terminated with exit(1)", status: 1, stack: "1030/</o</<@https://noflash.eternagame.org/eternajs/dist/prod/bundles/edda34159a882d9967b4.js:1:847327\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371441\nP@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:88832\nvalue@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:371415\nvalue/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:400676\ns@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87743\nM/<@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:83:87888\nl@https://noflash.eternagame.org/eternajs/dist/prod/main.e86fdaafd69ba3b9747a.js:69:8272\n" }
NuPACK.ts:101:16
Uncaught error Error: Something went terribly wrong in score_structures() Eterna.ts:37:8
[Show/hide message details.] Error: Something went terribly wrong in score_structures() NuPACK.ts:130:26
Uncaught error TypeError: this._seqStacks[this._stackLevel][e] is undefined Eterna.ts:37:8
[Show/hide message details.] TypeError: this._seqStacks[this._stackLevel][e] is undefined[Learn More] PoseEditMode.ts:1930:12
Hide chat on entering data browser
Refactor Constraints
Constraints should be reimplemented as an interface, where each constraint would provide appropriate images, validation, etc. As noted by @tconkling, UI/logic decoupling in ConstraintBox is also desirable.
Tutorial Validation
Per EteRNAgame/eterna#131
We had talked about pre-validating a tutorial as opposed to just breaking the entire puzzle at runtime. I'm imagining throwing a descriptive error when trying to load the puzzle with a tutorial if it fails to parse (ideally with a link to the author's profile to ask them to fix it, or if it's a tutorial progression puzzle a link to the forums), then allowing the player to go through to the puzzle without the tutorial if the tutorial is invalid (ie, if a player submitted a script that just fails to compile, it won't prevent other users from solving the puzzle and "blocking off" the potential points, which is a current concern).
Ideally a tutorial could be validated at the time it's submitted - would it be possible to have a second entry point to the TS validator script (ie, a webpack output with JUST the required code to use an exported boolean validateScript(string src) function or such)? The way that the tutorial creator currently works is that there is a separate PHP page that has an HTML script editor (basically just a textinput) along side the flash game, and so what I want is when clicking the HTML submit button, it'd call that function and prevent submission if it fails.
Constraint feedback on switching between target/natural mode
Directly from Brourd
https://noflash.eternagame.org/game/solution/7657281/7690820/copyandview/
This error is a bit weird. It comes from the sound/animation of the switch between target/native mode.
If you switch to native mode (and vice versa) the constraint boxes turn red, the audio cue indicates that the design doesn't work, but then the constraint boxes fade to green.
It also states that puzzle constraints are not satisfied when attempting to submit.
Minimized and maxemized dot plots out of sync
From Brourd:
Coming from this lab https://eternagame.org/game/browse/8787268/ with this sequence AACCCUGGGUCGGCCGCCACUUAGGUAACGAAUGAGAUUUGUAGUCGCCUUCGUAAUCUCCGACUGAGGACCGGGACCCAGGGUA while using the mutation booster.
State number should not be visible for single-state puzzles
This is a regression that actually happened in the AS3 refactoring.
https://legacy_flash.eternagame.org/game/puzzle/9005330/
https://eternagame.org/game/puzzle/9005330/
Better handling of escape menu/chat interaction
This looks kinda meh:
Dunno if the best option would be to reimplement in HTML, or if there's just some other way to make this not feel as wonky without forcing it to be over the chatbox
Can we drop the default relative position of eternaContainer?
https://github.com/EteRNAgame/EternaJS/blob/db1fcbf/src/eterna/EternaApp.ts#L102
If we could drop that line it would be best, but need to verify that it isn't needed to lay out the child elements properly
Puzzle maker creates erronous locks when locking after reset
Via Brourd:
In puzzlemaker, when any nucleotide in the puzzle is mutated to a non-A residue, and the sequence is reset, upon using any of the tools in editor [puzzle edit pallete] (locking bases, adding bases, adding base pairs, deleting an element), all nucleotides in the puzzle will be locked
No issue seems to occur using adding a molecule, and when using "lock" it only locks bases earlier in the strand than the base that was locked.
Missing settings
- In-game chat (don't know if this is already coded and just waiting for the chat to be ready to be integrated, but mentioning it just in case) 6645f68
- [ ] Low performance mode (rendering performance is so much better now, I'm not sure if this is even necessary, unless older computers struggle - perhaps it would still be useful to rebrand as "distraction-free mode" or something, just to get rid of the "visual noise"?Dropped in favor of #21 to happen eventually - Mute and volume level 996b199
Molecule is... Moving?
Not sure how to reproduce this, but Brourd saw this happen: https://drive.google.com/file/d/1DE-phQIBZRLiN0RFUZz3vxYjWOpJPYcN/view?usp=sharing
Advanced graphics options
Namely enabling/disabling graphical embellishments (basically the stuff that low perf mode handles now, but fine-grained for personal preference). This might include:
- Bubbles
- Background gradient
- Pair markers
- Strand directional markers
- Nucleotide animation (ie, how they always move back and forth )
- Antialiasing
- Molecule binding sight animation
- "Great pairing" notification
Prefilled bases seem to be offset
"Binding site" markers not centered on nucleotides
Nonregression, via Brourd:
User-reassignable hotkeys
Additional settings "tab" would be useful to allow for users to define their own hotkey mappings
Split off from #4
Puzzlemaker sequence input misplaced when resized
Directly via Brourd:
In all three browsers: In puzzlemaker, when you change the size of the window, and then you maximize the size again, the position of the dotplot input field is re-positioned off center of the screen.
Missing constraint images
Design browser view/copy fails with magic glue
Reported by Brourd
If you use magic glue (alt+click) within a (lab) puzzle (ie, https://noflash.eternagame.org/game/puzzle/8791823/), then go into the design browser and hit view/copy on a solution, it fails to actually load the solution, and the U/D keys also no longer work (though that may just be a trickle down effect).
Red coloring for unbound molecule missing
Via Brourd
Flash:
JS:
Zoom/mousewheel sensitivity option
Zama mentioned that using the applet mouse with her mac, zoom is extremely touchy. Would be great to have a zoom sensitivity option, perhaps with other control options per #4
Loading of puzzles with oligos hangs
Design browser view/copy fails when running booster
Reported by Brourd
Same as #52, but Brourd tried using the browser while the mutation booster was running. This definitely runs into the whole issue of the current script system being borked, but it is a regression so it should be able to be resolved. If this just can't be fixed for some reason, we'll remove it from the v1 milestone.
Oligo mode enum
Currently Pose2D has set:
public static readonly OLIGO_MODE_DIMER: number = 1;
public static readonly OLIGO_MODE_EXT3P: number = 2;
public static readonly OLIGO_MODE_EXT5P: number = 3;This should likely be an enum.
Note - this is referred to elsewhere as just an int which should also be addressed, such as in calls to set_oligo.
Screenshot in Puzzlemaker
Even though the web pages say I am logged in, clicking on the screenshot icon in Puzzlemaker produces "Error: Failed to post screenshot: You need to be logged in to take a screenshot".
Total energy dissapears on puzzle solve
The "total energy" box in the top-left hand corner disappears after a puzzle has been solved, but the user hits the "continue" button
Improve UX for bad characters in pasted sequence
"Copy sequence" doesn't copy directly to clipboard
We've discussed this before, but it was left as the current behavior of "present a textbox and have the user copy it themselves" due to implementation complexity/not knowing how to properly implement it. That said, I know there is a way to copy paste on a link/button click, as I've seen it before (iirc, you have to have the text on the page already, but I can't remember the details).
Puzzle title doesn't wrap in MS Edge
Via Brourd
Puzzle thumbnail offset
Lag on adding a molecule in puzzle maker
Via Brourd
The entire game freezes for a good second or so when adding a molecule, which does not occur in Flash.
Substructure highlight "stuck" switching to engine without support
Direct text from Brourd
Implementation of LinearFold appears to mostly work. Given there aren't free energy values (in game), the animation for highlighting a secondary structure element doesn't exist, and if an element is moused over (and highlighted), and then the model is changed from NUPACK to LinearFold, the highlight animation remains.
Sequence stamper issues
There are a number of observations that may or may not share a root cause.
- The location and ordering of the double stampers has changed.
- When the stamper is applied to one state, the sequence in the other state is not updated.
- The yellow outlining around the stamped sequence is not removed
There may be others symptoms, but I'm hoping fixing these will fix any closing related issues.
FWIW: The puzzle we've been testing with is https://noflash.eternagame.org/game/puzzle/8787266/
No "spotlight" in the center of the screen
Historically there's been a giant white gradient in the middle of the screen:
Brourd said he didn't like it anyways, and I can see it as kinda cluttering. Personally I feel that not having it, the background too dark and hard on the eyes, especially at low screen brightness. Brourd and I agree that it would be best to just lighten up the background a little bit and not have the gradient.
@sharife Any thoughts?
Spotlight effect differs by browser
Screenshots by Brourd
Chrome:
Firefix and Edge:
Original:
"click on structure constraint box to highlight the parts of the puzzle that are misfolding" feature is unimplemented/broken
Clicking on a folding icon that shows some red should outline the offending bases in the game.
Molecule brightness oscelation not present
Via Brourd: https://drive.google.com/file/d/1KOypVBrJogo_OlGvWszulrttsY2vJCfD/view?usp=sharing
Also
The molecule animation in noflash is super bright, and seems to be 'vibrating' (for lack of a better term that I can think of right now)
Although, it may be missing some frames or something in the animation.
I'm sure that there is a complaint somewhere that the bases of the binding site aren't marked well enough, given in flash it looks far more subdued, but the noflash version reminds me of how it probably looked before some update. It seems to me that it used to be super bright.
Molecule bonus is rounded in the total energy box
Originally reported by Brourd
Original:
Current:
Scrollwheel should impact verticle scrollbar in design browser
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.