Git Product home page Git Product logo

bwt-lcp-parallel's Introduction

bwt_lcp

Multi-threaded construction of multistring BWT and LCP array.

Input and Output

The input for this program should be a FASTA file on the alphabet {A, C, G, T}. Some examples are provided in the directory tests/.
The output of the program are the BWT and the LCP array of the collection of strings in the input file. After the main command execution, the binary-encoded BWT is contained in the file outfile-BWT.bin, while the binary LCP array is contained in the file outfile-LCP.bin. Each entry of the latter file is a 8-bit unsigned integer with the only exception of -1 encoded as 0xFF.

Compiling and running

After cloning the repository, issue the following command:

make bin

(Any modern C++ compiler should suffice for compiling the program.)

Now it is possible to run the program as follows:

./bwt_lcp <path to the FASTA file> <no of threads>

To output the ASCII version of the BWT use the decode_bwt tool as follows:

./decode_bwt <path to outfile-BWT.bin>

Test instances

Some test instances are provided in the repository. To run them, one can issue the command make test.

Citation

Paola Bonizzoni, Gianluca Della Vedova, Yuri Pirola, Marco Previtali, and Raffaella Rizzi (2019).
Multithread Multistring Burrows–Wheeler Transform and Longest Common Prefix Array.
Journal of Computational Biology, 26(9), 948–961.

DOI: 10.1089/cmb.2018.0230

Paola Bonizzoni, Gianluca Della Vedova, Serena Nicosia, Yuri Pirola, Marco Previtali, and Raffaella Rizzi (2018).
Divide and Conquer Computation of the Multi-string BWT and LCP Array.
CiE 2018: 107-117

DOI: 978-3-319-94418-0_11

bwt-lcp-parallel's People

Contributors

yp avatar

Stargazers

 avatar  avatar  avatar

Watchers

 avatar  avatar  avatar  avatar  avatar  avatar

bwt-lcp-parallel's Issues

Results change with each running when using multi-threads

I tried this program, but results change with each running when using multi-threads.
The execution environment is as follows:

  • OS: Ubuntu 18.04.2 LTS
  • cpu cores : 8

I did an experiment for following data (test.fasta) using 8 threads.

Data (test.fasta)

>read1
GTCCGTACGTACTGCATGCAGTACTGGTCAGTCAGTCGTACGTACGTCG

Command

$ ./bwt_lcp test.fasta 8

Then, the following BWT strings was output for each execution. (decoded by ./decode_bwt )

GTTTTTCCCCGTTGTTTCAAAAACTTTCCCCAGA$CAGGGGGGGGGGACC
GTTTTTCCCCGTTGTTTCAAAAACTTTCCCCAGA$CAGGGGGGGGGGCAC

I think the first one is correct.

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.