Git Product home page Git Product logo

linearpartition's Introduction

LinearPartition: Linear-Time Approximation of RNA Folding Partition Function and Base Pairing Probabilities

This repository contains the C++ source code for the LinearPartition project, the first linear-time partition function and base pair probabilities calculation algorithm/software for RNA secondary structures.

LinearPartition: Linear-Time Approximation of RNA Folding Partition Function and Base Pairing Probabilities

He Zhang, Liang Zhang, David Mathews, Liang Huang*

* corresponding author

Dependencies

gcc 4.8.5 or above; python2.7

To Compile

make

To Run

LinearPartition can be run with:

echo SEQUENCE | ./linearpartition [OPTIONS]

OR

cat SEQ_OR_FASTA_FILE | ./linearpartition [OPTIONS]

Both FASTA format and pure-sequence format are supported for input.

OPTIONS:

-b BEAM_SIZE

The beam size (default 100). Use 0 for infinite beam.

-V

Switches LinearPartition-C (by default) to LinearPartition-V.

--verbose

Prints out beamsize, Log Partition Coefficient or free energy of ensemble (-V mode) and runtime information. (default False)

--sharpturn

Enable sharpturn. (default False)

-o

Outputs base pairing probability matrix to a file with user specified name. (default False)

--prefix

Outputs base pairing probability matrices to files with user specified prefix. (default False)

-p

Partition function calculation only. (default False)

Example: Run Predict

cat testseq | ./linearpartition -V --prefix testseq_output
UGAGUUCUCGAUCUCUAAAAUCG
Free Energy of Ensemble: -1.96 kcal/mol
Outputing base pairing probability matrix to testseq_output_1...
Done!
AAAACGGUCCUUAUCAGGACCAAACA
Free Energy of Ensemble: -9.41 kcal/mol
Outputing base pairing probability matrix to testseq_output_2...
Done!
AUUCUUGCUUCAACAGUGUUUGAACGGAAU
Free Energy of Ensemble: -7.72 kcal/mol
Outputing base pairing probability matrix to testseq_output_3...
Done!
UCGGCCACAAACACACAAUCUACUGUUGGUCGA
Free Energy of Ensemble: -9.09 kcal/mol
Outputing base pairing probability matrix to testseq_output_4...
Done!
GUUUUUAUCUUACACACGCUUGUGUAAGAUAGUUA
Free Energy of Ensemble: -13.58 kcal/mol
Outputing base pairing probability matrix to testseq_output_5...
Done!

echo GGGCUCGUAGAUCAGCGGUAGAUCGCUUCCUUCGCAAGGAAGCCCUGGGUUCAAAUCCCAGCGAGUCCACCA | ./linearpartition -o output
GGGCUCGUAGAUCAGCGGUAGAUCGCUUCCUUCGCAAGGAAGCCCUGGGUUCAAAUCCCAGCGAGUCCACCA
Log Partition Coefficient: 15.88268
Partition Function Calculation Time: 0.004343 seconds.
Base Pairing Probabilities Calculation Time: 0.003293 seconds.
Outputing base pairing probability matrix to output...
Done!

Example: Run Partition Function Calculation Only

echo GGGCUCGUAGAUCAGCGGUAGAUCGCUUCCUUCGCAAGGAAGCCCUGGGUUCAAAUCCCAGCGAGUCCACCA | ./linearpartition -V -p --verbose
beam size: 100
GGGCUCGUAGAUCAGCGGUAGAUCGCUUCCUUCGCAAGGAAGCCCUGGGUUCAAAUCCCAGCGAGUCCACCA
Free Energy of Ensemble: -32.14 kcal/mol
Partition Function Calculation Time: 0.005509 seconds.

linearpartition's People

Contributors

vincentzhangor avatar linearfold avatar lianghuang3 avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.