Git Product home page Git Product logo

ngi-smrnaseq's Introduction

NGI-smRNAseq

Build Status Nextflow

This pipeline has moved

This pipeline has been moved to the new nf-core GitHub organisation. You can now find it here:

https://github.com/nf-core/smrnaseq

This repository will be archived to maintain the release version for future reproducibility, to allow reruns.

If you have any questions, please get in touch: [email protected]

// Phil Ewels, 2018-07-12


NGI-smRNAseq is a bioinformatics best-practice analysis pipeline used for small RNA sequencing data at the National Genomics Infastructure at SciLifeLab Stockholm, Sweden.

The pipeline uses Nextflow, a bioinformatics workflow tool. It pre-processes raw data from FastQ inputs, aligns the reads and performs extensive quality-control on the results.

This pipeline is primarily used with a SLURM cluster on the Swedish UPPMAX systems. However, the pipeline should be able to run on any system that Nextflow supports. We have done some limited testing using Docker and AWS, and the pipeline comes with some configuration for these systems. See the installation docs for more information.

Installation

NextFlow installation

See https://github.com/SciLifeLab/NGI-NextflowDocs for instructions on how to install and configure Nextflow.

Pipeline installation

This pipeline itself needs no installation - NextFlow will automatically fetch it from GitHub when run if SciLifeLab/NGI-smRNAseq is specified as the pipeline name.

If you prefer, you can download the files yourself from GitHub and run them directly:

git clone https://github.com/SciLifeLab/NGI-smRNAseq.git
nextflow run NGI-smRNAseq/main.nf

Installation of the 'ngi_visualizations' module

This module needs to be installed locally in order to visualize the statistics from Bowtie2 alignment.

pip install -U git+https://github.com/NationalGenomicsInfrastructure/ngi_visualizations.git

Note that for ngi_visualizations, python packages HTSeq and pysam are required.

Installation of the NGI plugin for the'MultiQC' module

pip install git+https://github.com/ewels/MultiQC_NGI.git

Configuration

By default, the pipeline is configured to run on the Swedish UPPMAX cluster (milou / irma).

You will need to specify your UPPMAX project ID when running a pipeline. To do this, use the command line flag --project <project_ID>.

To avoid having to specify this every time you run Nextflow, you can add it to your personal Nextflow config file instead. Add this line to ~/.nextflow/config:

params.project = 'project_ID'

The pipeline will exit with an error message if you try to run it pipeline with the default UPPMAX config profile and don't set project.

Running on other clusters

It is entirely possible to run this pipeline on other clusters, though you will need to set up your own config file so that the script knows where to find your reference files and how your cluster works.

Copy the contents of conf/uppmax.config to your own config file somewhere and then reference it with -c when running the pipeline.

If you think that there are other people using the pipeline who would benefit from your configuration (eg. other common cluster setups), please let us know. It should be easy to create a new config file in conf and reference this as a named profile in nextflow.config. Then these configuration options can be used by specifying -profile <name> when running the pipeline.

Running the pipeline

The typical command for running the pipeline is as follows:

nextflow run SciLifeLab/NGI-smRNAseq --reads '*.fastq.gz'

NOTE! Paired-end data is NOT supported by this pipeline! For paired-end data, use Read 1 only. For instance:

nextflow run SciLifeLab/NGI-smRNAseq --reads '*.R1.fastq.gz'

Note that the pipeline will create files in your working directory:

work            # Directory containing the nextflow working files
results         # Finished results for each sample, one directory per pipeline step
.nextflow_log   # Log file from Nextflow
# Other nextflow hidden files, eg. history of pipeline runs and old logs.

Mandatory parameters

--reads

Location of the input FastQ files:

 --reads 'path/to/data/*.fastq.gz'

NOTE! Must be enclosed in quotes! If left unspecified, the pipeline will assume that the data is in a directory called data in the working directory.

--genome

The reference genome to use of the analysis, needs to be one of the genome specified in the config file. The human GRCh37 genome is used by default.

--genome 'GRCh37'

Supported genomes

Parameter Latin Name Common Name
AGPv3 Zea mays Maize
BDGP6 Drosophila melanogaster Fruit fly
CanFam3.1 Canis familiaris Dog
CHIMP2.1.4 Pan troglodytes Chimpanze
EquCab2 Equus caballus Horse
Galgal4 Gallus gallus Chicken
Gm01 Glycine max Soybean
GRCh37 Homo sapiens Human
GRCm38 Mus musculus Mouse
GRCz10 Danio rerio Zebrafish
IRGSP-1.0 Oryza sativa japonica Rice
Mmul_1 Macaca mulatta Macaque
Rnor_6.0 Rattus norvegicus Rat
Sbi1 Sorghum bicolor Great millet
Sscrofa10.2 Sus scrofa Pig
TAIR10 Arabidopsis thaliana Thale cress
UMD3.1 Bos taurus Cow
WBcel235 Caenorhabditis elegans Nematode

NOTE! With the option --genome 'ALL', the entire dataset of mature miRNAs and hairpins in miRBase will be used as reference regardless of species. Meanwhile the alignment against host reference genome will be skipped.

Other command line parameters

--outdir

The output directory where the results will be saved.

--email

Set this parameter to your e-mail address to get a summary e-mail with details of the run sent to you when the workflow exits. If set in your user config file (~/.nextflow/config) then you don't need to speicfy this on the command line for every run.

--plaintext_email

Set to receive plain-text e-mails instead of HTML formatted.

-name

Name for the pipeline run. If not specified, Nextflow will automatically generate a random mnemonic.

This is used in the MultiQC report (if not default) and in the summary HTML / e-mail (always).

NB: Single hyphen (core Nextflow option)

-resume

Specify this when restarting a pipeline. Nextflow will used cached results from any pipeline steps where the inputs are the same, continuing from where it got to previously.

You can also supply a run name to resume a specific run: -resume [run-name]. Use the nextflow log command to show previous run names.

NB: Single hyphen (core Nextflow option)

-c

Specify the path to a specific config file (this is a core NextFlow command). Useful if using different UPPMAX projects or different sets of reference genomes. NOTE! One hyphen only (core Nextflow parameter).

NB: Single hyphen (core Nextflow option)

Note - you can use this to override defaults. For example, we run on UPPMAX but don't want to use the MultiQC environment module as is the default. So we specify a config file using -c that contains the following:

process.$multiqc.module = []

--bt2index

If you prefer, you can specify the full path to your reference genome when you run the pipeline:

--bt2index [path to Bowtie2 index]

--rlocation

Some steps in the pipeline run R with required modules. By default, the pipeline will install these modules to ~/R/nxtflow_libs/ if not present. You can specify what path to use with this command line flag.

Trimming options

--length [int]: Discard reads that became shorter than length [int] because of either quality or adapter trimming. Default: 18 --clip_R1 [int]: Instructs Trim Galore to remove bp from the 5' end of read 1 --three_prime_clip_R1 [int]: Instructs Trim Galore to remove bp from the 3' end of read 1 AFTER adapter/quality trimming has been performed

--saveReference

Supply this parameter to save any generated reference genome files to your results folder. These can then be used for future pipeline runs, reducing processing times.

--multiqc_config

If you would like to supply a custom config file to MultiQC, you can specify a path with --multiqc_config. This is used instead of the config file specific to the pipeline.

--clusterOptions

Submit arbitrary SLURM options (UPPMAX profile only). For instance, you could use --clusterOptions '-p devcore' to run on the development node (though won't work with default process time requests).

Stand-alone scripts

The bin directory contains some scripts used by the pipeline which may also be run manually:

  • edgeR_miRBase.r
    • R script using for processing reads counts of mature miRNAs and miRNA precursors (hairpins).

Credits

These scripts were written for use at the National Genomics Infrastructure at SciLifeLab in Stockholm, Sweden.

Written by Phil Ewels (@ewels), Chuan Wang (@chuan-wang) and Rickard Hammarén (@Hammarn)

ngi-smrnaseq's People

Contributors

chuan-wang avatar ewels avatar pditommaso avatar

Stargazers

 avatar  avatar  avatar  avatar  avatar

Watchers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

ngi-smrnaseq's Issues

seed length bowtie and multimappers

First of all, thanks for this great pipeline!

I have a question regarding the mapping parameters supplied to bowtie when mapping reads to the mature miRBASE database. If I am not mistaken, by setting the seed length to 15 (as done here by -l 15), there are no mismatches allowed in the 15 leftmost nucleotides but mismatches from nucleotide 16 on are allowed and reported as valid hits. In my dataset this seems to result in a substantial number of miRNAs that only differ in the 3'end getting the exact same counts... I'm a novice at miRNA analysis so I was wondering whether there is there a reason for fixing this parameter at 15? Thanks!

How to cite your work? PMID =?

We have recently completed a simple project on human next-generation data analysis. And in the pipeline, we used the small RNA/ mRNA/ChIP QC pipelines from your Github account. I googled the SciLifeLab projects, there seems no published paper on your work. How can I show my respect to your work?

Think about mapping against hairpin only

Marc thinks that mapping again only hairpin miRBase reads could be a better approach:

  • Map against hairpin only
    • Check mapping within the mature region
    • Allow overlap of 1bp at 5' end
    • Allow 2 bp overlap at 3' end
  • Treat the 5' and 3' arm alignments separately
  • Allow a single mismatch in mapping

Remove samtools and mature mapping step. Have a custom script to do filtering and counting.

Use bowtie 1 for human genome alignment

Probably shouldn't have put Bowtie 2 into the latest change.

Need to read this paper and take on advice:
http://bib.oxfordjournals.org/content/16/6/950.full

Alignments performed using Bowtie 2 resulted in an even greater number of miRNAs with higher counts; examination of the alignment output revealed that many of these were attributed to the allowance of insertions and deletions.

Bowtie 2, which was developed for gapped alignment, was included in our comparison to illustrate the consequences of selecting an inappropriate aligner.

Nextflow v26 throws error

The latest version of Nextflow throws an error and halts execution if there are multiple files with the same filename. This now crashes this pipeline (see latest travis builds).

Need to trim small RNA adapter

The pipeline doesn't currently trim the small RNA adapter. TrimGalore command should be:

trim_galore --gzip --adapter ATGGAATTCTCG --fastqc_args "-q" ${reads}

Current data has this as overrepresented sequence, (end is the reverse complement of the above adapter):

GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCT

Add option for sequencing centre in BAM file

Bowtie 1

Output options:
--sam-RG <text>
Add (usually of the form TAG:VAL, e.g. ID:IL7LANE2) as a field on the @rg header line. Specify --sam-RG multiple times to set multiple fields.
--sam-RG is ignored unless -S/--sam is also specified.

Bowtie2

SAM options:
--rg

Add (usually of the form TAG:VAL, e.g. SM:Pool1) as a field on the @rg header line.

e.g.:
--rg CN:nameofourgroup

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.