omnicoders / bio-geolocation Goto Github PK

The following record has odd characters in the sequence name, which cause the output file to be corrupt because there are two > brackets in a row instead of a > and a sequence like the FASTA format specifies.

https://www.ncbi.nlm.nih.gov/nuccore/MF140467.1

The output line looks like this:

MF140467.1 Coprinellus sp. Ireland: Gurraig
:2282 internal transcribed spacer 1, partial sequence; 5.8 internal transcribed No Location Provided
CCTGCGGAAGGATCATTAACGAATAACTATGGTGTCTTGGTTGTAGCTGGCTCCTCGGAGCATTGTGCACGCCCGCCATT

Correct output should be:

MF140467.1 Coprinellus sp. Ireland: Gurraig
CCTGCGGAAGGATCATTAACGAATAACTATGGTGTCTTGGTTGTAGCTGGCTCCTCGGAGCATTGTGCACGCCCGCCATT

Here is a FASTA file that will hang the code:

X>HQ604824.1 Amanita gemmata isolate BD 34 voucher UBC:F19764 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
ACCC

Remove the X to make it back into a valid FASTA, otherwise github thinks it's a quote.

Some of the sequences are missing from the result file that are present in the source file.

Source File

>FJ475559.1 Uncultured Suillaceae clone AhedenA42 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence >FN565360.1 Uncultured Suillus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene (partial), clone 7.17 >FN565362.1 Uncultured Suillus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene (partial), clone 7.13 >FN565363.1 Uncultured Suillus 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene (partial), clone 6.17
CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAATAATCT
CGAGGGCCTTCGGAAAGGAGAGAGGGTTGTAGCTGGCTTAAGCATGTGCACGCCCTCTTTCTCGACCTAGGTCCTTATGG
GCGCGGGGCGACCCGCGTCTTCATAAGCCCCTTCGTGTAGAAAGTCTATGAATGTTTTTACCATCATCGACTCGCGACTT
CTAGGAGACGCGATTCTTTGAGACAAAAGTTATTACAACTTTCAGCAATGGATCTCTTGGCTCTCGCATCGATGAAGAAC
GCAGCGAATCGCGATATGTAATGTGAATTGCAGATCTACAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTTATCGG
TGTTCCGATGAGCATGCCTGTTTGAGCGTCATTAAATTCTCAACCCCTCTCGATTTGCTTCGAGAGGGAGCTTGGATCGT
GGAGGCTGCCGGAGACCTGTTTTTCAGGACTCGGGCTCCTCTGAAATGTATTGGCTTGCGGTCGACTTTCGACTGTGCAT
GACAAGGCCTTTGGCGTGATAATGATCGCCGCTCGCCGAAGTGCACGAACGAATGGTCTCGTGCCTCTAATCAGTCGACG
CCTTTTCGAAGGCGTCTTCCTTATTGACGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA
GCGGAGGA

Result File

>FJ475559.1 Uncultured Suillaceae Sweden

Most species are just two words - the genus and the species. However when we know the genus but the species is a guess, the abbreviation cf. or aff. is used to indicate that it's not necessarily that species.

Here is an example FASTA file which truncates the species name:

X>MG827096.1 Amanita cf. pantherina voucher MushroomObserver.org/306343 internal
transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence
AAACTCAGGTAGGGGGGGAGGTGGTTGTAGCTGGCCCCCTAGTAAGGGCATGTGCACACTGTCTCTTTCTCTTGCTTGTTTTTTTCATTCTTTCCACTTGTGCACTGCTTGTAGGCAGCCTGGCATTGTTCAGGTTGTCTATGATTTTCTTTACATACATGAATAATCGTTGTACAGAATGTAATGAAAAAAAAAGTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATC

Remove the X before the > - I just put it there so Github wouldn't see the carat as a quote.

When I made a phylogenetic tree of Psilocybe sect. Aztecorum, three collections from the Czech republic showed up as being from Oregon.

The country field is set to Czech republic.

Here is the fasta file, renamed to txt

aztecorum.txt

Parenthesis and probably other funny characters too should be stripped, as they cause bad output to be written.

An example of a record which causes this issue is https://www.ncbi.nlm.nih.gov/nuccore/MF423716