Git Product home page Git Product logo

longestsubsequence's Introduction

README

Longest-Subsequence

#Summary Given two strings with the characters "ACGT" This program will print the longest subsequence using dynamic programming.

This program was as a homework assignment for Dr. Gerry Howser, Design and Analysis of Algorithms, Kalamazoo College.

This program was bench checked (checked with pencil and paper) for two random DNA strings of 5 to 6 characters (characters limited to "ACGT")

Finally this program was used to find the LCS (longest common subsequence) for the two strings:

S1 = ACCGGTCGAGTGCGCGGAAGCCGGCCGAA S2 = GTCGTTCGGAATGCCGTTGCTCTGTAAA.

The bench check and final results for the two strings can be verified in the JPEG images in the repository

longestsubsequence's People

Contributors

mraediaz avatar

Watchers

 avatar  avatar

Forkers

naoya7483

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.