ntHash is a recursive hash function for hashing all possible k-mers in a DNA/RNA sequence.
$ ./autogen.sh
$ ./configure
$ make
$ sudo make install
To install nttest in a specified directory:
$ ./autogen.sh
$ ./configure --prefix=/opt/ntHash/
$ make
$ make install
The nttest suite has the options for runtime and uniformity tests.
For the runtime test the program has the following options:
nttest [OPTIONS] ... [FILE]
Parameters:
-k
,--kmer=SIZE
: the length of k-mer used for runtime test hashing[50]
-h
,--hash=SIZE
: the number of generated hashes for each k-mer[1]
FILE
: is the input fasta or fastq file
For example to evaluate the runtime of different hash methods on the test file reads.fa
in DATA/ folder for k-mer length 50
, run:
$ nttest -k50 reads.fa
For the uniformity test using the Bloom filter data structure the program has the following options:
nttest --uniformity [OPTIONS] ... [REF_FILE] [QUERY_FILE]
Parameters:
-q
,--qnum=SIZE
: number of queries in query file-l
,--qlen=SIZE
: length of reads in query file-t
,--tnum=SIZE
: number of sequences in reference file-g
,--tlen=SIZE
: length of reference sequence-i
,--input
: generate random query and reference files-j
,threads=SIZE
: number of threads to run uniformity test[1]
REF_FILE
: the reference file nameQUERY_FILE
: the query file name
For example, to evaluate the uniformity of different hash methods using the Bloom filter data structure on randomly generated data sets with following options:
100
genes of length5,000,000bp
as reference in filegenes.fa
4,000,000
reads of length250bp
as query in filereads.fa
12
threads
run:
$ nttest --uniformity --input -q4000000 -l250 -t100 -g5000000 -j12 genes.fa reads.fa
To hash all k-mers of length k
in a given sequence seq
:
string kmer = seq.substr(0, k);
uint64_t hVal=0;
hVal = NTF64(kmer.c_str(), k); // initial hash value
...
for (size_t i = 0; i < seq.length() - k; i++)
{
hVal = NTF64(hVal, seq[i], seq[i+k], k); // consecutive hash values
...
}
To canonical hash all k-mers of length k
in a given sequence seq
:
string kmer = seq.substr(0, k);
uint64_t hVal, fhVal=0, rhVal=0; // canonical, forward, and reverse-strand hash values
hVal = NTC64(kmer.c_str(), k, fhVal, rhVal); // initial hash value
...
for (size_t i = 0; i < seq.length() - k; i++)
{
hVal = NTC64(seq[i], seq[i+k], k, fhVal, rhVal); // consecutive hash values
...
}
To multi-hash with h
hash values all k-mers of length k
in a given sequence seq
:
string kmer = seq.substr(0, k);
uint64_t hVec[h];
NTM64(kmer.c_str(), k, h, hVec); // initial hash vector
...
for (size_t i = 0; i < seq.length() - k; i++)
{
NTM64(seq[i], seq[i+k], k, h, hVec); // consecutive hash vectors
...
}
Enables ntHash on sequences
To hash all k-mers of length k
in a given sequence seq
with h
hash values using ntHashIterator:
ntHashIterator itr(seq, h, k);
while (itr != itr.end())
{
... use *itr ...
++itr;
}
Outputing hash values of all k-mers in a sequence
#include <iostream>
#include <string>
#include "ntHashIterator.hpp"
int main(int argc, const char* argv[])
{
/* test sequence */
std::string seq = "GAGTGTCAAACATTCAGACAACAGCAGGGGTGCTCTGGAATCCTATGTGAGGAACAAACATTCAGGCCACAGTAG";
/* k is the k-mer length */
unsigned k = 70;
/* h is the number of hashes for each k-mer */
unsigned h = 1;
/* init ntHash state and compute hash values for first k-mer */
ntHashIterator itr(seq, h, k);
while (itr != itr.end()) {
std::cout << (*itr)[0] << std::endl;
++itr;
}
return 0;
}
Hamid Mohamadi, Justin Chu, Benjamin P Vandervalk, and Inanc Birol. ntHash: recursive nucleotide hashing. Bioinformatics (2016) 32 (22): 3492-3494. doi:10.1093/bioinformatics/btw397
This projects uses:
- CATCH unit test framework for C/C++