Software implementation of HFold.
HFold is an algorithm for predicting the pseudoknotted secondary structures of RNA using strict Hierarchical Folding.
Jabbari, H., Condon, A., Pop, A., Pop, C., Zhao, Y. (2007). HFold: RNA Pseudoknotted Secondary Structure Prediction Using Hierarchical Folding. In: Giancarlo, R., Hannenhalli, S. (eds) Algorithms in Bioinformatics. WABI 2007. Lecture Notes in Computer Science, vol 4645. Springer, Berlin, Heidelberg. https://doi.org/10.1007/978-3-540-74126-8_30
Jabbari, H., Condon, A., Zhao Y. Novel and Efficient RNA Secondary Structure Prediction Using Hierarchical Folding.Journal of Computational Biology.Mar 2008.139-163. http://doi.org/10.1089/cmb.2007.0198
Linux macOS
Requirements: A compiler that supports C++11 standard (tested with g++ version 4.7.2 or higher) and CMake version 3.1 or greater.
CMake version 3.1 or greater must be installed in a way that HFold can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:
cmake --version
If it does not print a cmake version greater than or equal to 3.1, you will have to install CMake depending on your operating system.
Easiest way is to install homebrew and use that to install CMake.
To do so, run the following from a terminal to install homebrew:
/usr/bin/ruby -e "$(curl -fsSL https://raw.githubusercontent.com/Homebrew/install/master/install)"
When that finishes, run the following from a terminal to install CMake.
brew install cmake
Run from a terminal
wget http://www.cmake.org/files/v3.8/cmake-3.8.2.tar.gz
tar xzf cmake-3.8.2.tar.gz
cd cmake-3.8.2
./configure
make
make install
- Download the repository and extract the files onto your system.
- From a command line in the root directory (where this README.md is) run
cmake -H. -Bbuild
cmake --build build
If you need to specify a specific compiler, such as g++, you can instead run something like
cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build
This can be useful if you are getting errors about your compiler not having C++11 features.
After installing you can move the executables wherever you wish, but you should not delete or move the simfold folder, or you must recompile the executables. If you move the folders and wish to recompile, you should first delete the created "build" folder before recompiling.
Arguments:
HFold:
-s <sequence>
-r <structure>
-i </path/to/file>
-o </path/to/file>
Remarks:
make sure the <arguments> are enclosed in "", for example -r "..().." instead of -r ..()..
input file for -i must be .txt
if -i is provided with just a file name without a path, it is assuming the file is in the diretory where the executable is called
if -o is provided with just a file name without a path, the output file will be generated in the diretory where the executable is called
if -o is provided with just a file name without a path, and if -i is provided, then the output file will be generated in the directory where the input file is located
Sequence requirements:
containing only characters GCAUT
Structure requirements:
-pseudoknot free
-containing only characters ._(){}[]
Remarks:
Restricted structure symbols:
() restricted base pair
_ no restriction
Input file requirements:
Line1: Sequence
Line2: Structure
sample:
GCAACGAUGACAUACAUCGCUAGUCGACGC
(____________________________)
assume you are in the directory where the HFold executable is loacted
./HFold --i "/home/username/Desktop/myinputfile.txt"
./HFold --i "/home/username/Desktop/myinputfile.txt" --o "outputfile.txt"
./HFold --i "/home/username/Desktop/myinputfile.txt" --o "/home/username/Desktop/some_folder/outputfile.txt"
./HFold --s "GCAACGAUGACAUACAUCGCUAGUCGACGC" --r "(____________________________)"
./HFold --s "GCAACGAUGACAUACAUCGCUAGUCGACGC" --r "(____________________________)" --o "outputfile.txt"
./HFold --s "GCAACGAUGACAUACAUCGCUAGUCGACGC" --r "(____________________________)" --o "/home/username/Desktop/some_folder/outputfile.txt"
0 success
1 invalid argument error
3 thread error
4 i/o error
5 pipe error
error code with special meaning: http://tldp.org/LDP/abs/html/exitcodes.html
2 Misuse of shell builtins (according to Bash documentation)
126 Command invoked cannot execute
127 "command not found"
128 Invalid argument to exit
128+n Fatal error signal "n"
130 Script terminated by Control-C
255 Exit status out of range (range is 0-255)
React
Typescript
Django
Laravel
Facebook
Microsoft
Google
Alibaba
D3
Tencent