Git Product home page Git Product logo

deepbind's Introduction

DEEPBIND v0.1
-------------

The deepbind command-line executable can be used to score DNA/RNA sequences
according to any RBP/TF model listed in the DeepBind web repository:

   http://tools.genes.toronto.edu/deepbind

For each input sequence, the deepbind executable scores each subsequence
of a pre-determined length (e.g. 20) and returns only the maximum score over
all positions.


EXAMPLE
-------

To generate predictions with DeepBind, you need two things:

  1) a list of model IDs, and
  2) a list of DNA/RNA sequences.

The file example.ids contains 4 example model IDs, one
on each line, reproduced here:

   D00210.001 # RBFOX1 (RNAcompete)
   D00120.001 # MBNL1 (RNAcompete)
   D00410.003 # GATA3 (SELEX)
   D00328.003 # CTCF (SELEX)

The file example.seq contains 4 example sequences, which
were chosen such that the nth sequence scores highly for
the nth model. The file example.seq is reproduced here:

   AGGUAAUAAUUUGCAUGAAAUAACUUGGAGAGGAUAGC
   AGACAGAGCUUCCAUCAGCGCUAGCAGCAGAGACCAUU
   GAGGTTACGCGGCAAGATAA
   TACCACTAGGGGGCGCCACC

To generate 16 predictions (4 models, 4 sequences), run
the deepbind executable as follows:

   % deepbind example.ids < example.seq
   D00210.001   D00120.001   D00410.003   D00328.003
    7.345649    -0.152710    -0.763340    -0.026180
   -0.159393     3.663924    -0.196943    -0.026180
   -0.143584     0.357632     5.885349    -0.026180
   -0.161033    -0.081444    -0.379695    17.682623

To see details of each ID, use the --dump-info flag:

   % deepbind --dump-info example.ids
   ID          Protein  Type  Species       Family   Class  Experiment  ...
   D00210.001  RBFOX1   RBP   Homo sapiens  RRM             RNAcompete  ...
   D00120.001  MBNL1    RBP   Homo sapiens  Znf             RNAcompete  ...
   D00410.003  GATA3    TF    Homo sapiens  GATA            SELEX       ...
   D00328.003  CTCF     TF    Homo sapiens  znfC2H2         SELEX       ...

deepbind's People

Watchers

James Cloos avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.