huangliangbo / hapviz Goto Github PK
View Code? Open in Web Editor NEWThis project forked from ekg/hapviz
indel haplotype visualization on the command line from BAM files
This project forked from ekg/hapviz
indel haplotype visualization on the command line from BAM files
hapviz: region-bounded haplotype pileup visualization for BAM files it all happens in the terminal! % hapviz --help usage: hapviz [options] bam file [... bam file] options: -b, --bam bam file to from which to extract reads (may also be specified as positional arguments) -r, --region region from which to extract grouped reads -a, --show-all When visualizing, show all alignments, not just variant ones. -f, --reference FASTA reference against which alignments have been aligned -q, --min-base-quality minimum base quality required for all bases in a read Displays haplotype groups from the specified region across the BAM files provided as input. Note: If you list 'stdin' as one of the BAM files, you can pipe BAM directly into hapviz. This (slightly modified) example output shows how each indel haplotype is grouped, and the reads from it are aligned to a reference sequence. Relative deletions between the reference and reads are replaced by '-'. 17 i:16817:GGCAC 16788 CCCAGCACTTCAGGGCTTTAGCTGGGAGGGA-----GGCAGTCCACAGGAATGAATTCATCACT 16862 sample08 31M5I34M CCAGCACTTCAGGGCTTTAGCTGGGAGGGAGGCACGGCAGTCCACAGGAAT sample03 30M5I35M CAGCACTTCAGGGCTTTAGCTGGGAGGGAGGCACGGCAGTCCACAGGAATG sample02 27M5I38M GCACTTCAGGGCTTTAGCTGGGAGGGAGGCACGGCAGTCCACAGGAATGAAT sample05 26M5I39M CACTTCAGGGCTTTAGCTGGGAGGGAGGCACGGCAGTCCACAGGAATGAATT sample05 24M5I41M CTTCAGGGCTTTAGCTGGGAGGGAGGCACGGCAGTCCACAGGAATGAATTCA sample07 21M5I44M CAGGGCTTTAGCTGGGAGGGAGGCACGGCAGTCCACAGGAATGAATTCATCA sample07 21M5I44M CAGGGCTTTAGCTGGGAGGGAGGCACGGCAGTCCACAGGAATGAATTCATCA sample03 19M5I46M GGGCTTTAGCTGGGAGGGAGGCACGGCAGTCCACAGGAATGAATTCATCACT sample08 14M5I51M TTAGCTGGGAGGGAGGCACGGCAGTCCACAGGAATGAATTCATCACT -------------------------------------------------------------- 1 i:16817:GGCAG 16765 GTGCTGCCCTCTCCCCAGCACTTCAGGGCTTTAGCTGGGAGGGA-----GGCAGTCCACAGG 16829 sample03 52M5I13M GTGCTGCCCTCTCCCCAGCACTTCAGGGCTTTAGCTGGGAGGGAGGCAGGGCAGTCCACAGG -------------------------------------------------------------- 1 i:16821:T 16758 ATACAGGGTGCTGCCCTCTCCCCAGCACTTCAGGGCTTTAGCTGGGAGGGAGGCA-GTC 16823 sample03 63M1I3M3S ATACAGGGTGCTGCCCTCTCCCCAGCACTTCAGGGCTTTAGCTGGGAGGGAGGCATGTC -------------------------------------------------------------- Enjoy! author: erik garrison <[email protected]> license: free
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.