Provides on-target cleavage efficiency prediction for SpCas9-HF1.

Calculates an efficiency score for 23 base pair long spacer sequence(s) (with PAM) on separate lines. A Python 3 application that may be used as web application or a command line tool.

The requirements for running the application are documented in the Pipfile.

• Python 3.7
• dm-sonnet 1.11
• tensorflow 1.13.1

To install the dependencies Pipenv is required:

pipenv install

The application may be run locally, which will then be available at http://localhost:5000/

pipenv run app

Scores for multiple spacer sequences may be calculated in a batch:

To calculate a few sequences:

pipenv run calculator GCACGCCAAAGTACGCACGAGGG ...

Multiple sequences may be calculated at a time by reading from standard input:

echo GCACGCCAAAGTACGCACGAGGG | pipenv run calculator

The application makes use of:

• DeepActiveCRISPR
• DeepCas9