MANIFEST.in cheatsheet

\rm -rf ./build twobits.so
python setup.py build
ln -s build/lib.macosx-10.9-x86_64-3.8/*so twobits.so
python ./test.py

python setup.py sdist
python -m twine upload --repository-url https://upload.pypi.org/legacy/ dist/*

import twobits
twobits.encode("GCAGTTTGTAGTCGAAGACGGTCTTCGCATCG")
# returns 15252441178061577511
twobits.decode(15252441178061577511, 32)
# returns "GCAGTTTGTAGTCGAAGACGGTCTTCGCATCG"

twobits.encode("AA")
# Returns 0
twobits.decode(0, 2)
# Returns "AA"

Here, the sizes of the total and truncated words must be passed explicitely

longWord       = 'AAAAAAAAAGCGTTCACCCGTGG'
lenLongWord    = len(lonWord)                                # 23
longWordValue  = twobits.encode('AAAAAAAAAGCGTTCACCCGTGG')   # 233379311
shortWordValue = twobits.truncate(longWord, 23, 10)          # 595439

twobits.decode(shortWordValue, 10)
>>'TCACCCGTGG'

Truncation is always performed on the left-end side of the string.

gcc -Wall -std=c99 main.c custom_*.c two_bits_encoding.c -I./include -o setCompare -pedantic -lm

One file per genome, with sgRNA encoded as 64bits unsigned integers under the format described here.

./setCompare -i "IFILENAME1&IFILENAME2" -e FILE_EXTENSION \
-l FILES_LOCATION -f FILE_OUT \
-o "OFILENAME1&OFILENAME2"
-c 19

Where,

• IFILENAMEx is the name of a file carrying words to be included, list of such files uses the '&' separator
• OFILENAMEx is the name of a file carrying words to be excluded, list of such files uses the '&' separator [OPTIONAL]
• SEED_FILE is the absolute path to a list of integers to be included [OPTIONAL]
• FILE_OUT is the absolute path to the output file
• FILE_EXTENSION is the extension (with no dot) of the file specified by the -i, -o flags
• -c is the size of truncated word representations used for ensemble comparisons.

• 1st line stores total number of items
• Other lines store two integer fields, with the value of the number and a weight used for final sorting

11
2 5
5 3
7 1
8 1
10 5
15 7
22 12
89 1
333 1
100002 22
69022343222 33

Are reported the number of sets and operations, followed by the compostion of the final set with its values sorted on a single line by decreasing weight, with each item specified as value:weight.

{"comments" : "Final set (Intersect of 2 sets) - (Union of 0 sets)", "size" : 51, "codec" : "twobits", "length" : 23 }
# 7 items set
69022343222:66,100002:44,15:14,2:10,10:10,8:2,89:2

The header line is a json document of the following structure

{ 
    "comments" : "Final set (Intersect of 2 sets) - (Union of 0 sets)", // Summary of the seet operations
    "size" : 51,                                                        // Total number word satisfying set constraints
    "codec" : "twobits",                                                // encoding scheme
    "length" : 23                                                       // size of the corresponding sgRNA words
}

Here is a sample of the format

{"comments" : "Final set (Intersect of 2 sets) - (Union of 0 sets)", "size" : 4, "codec" : "twobits", "from" : 23, "to" : 3 }
# 4 items set
31:425900[237513503, ... ,10600922015]
47:225225[149430063, ... ,212042863]

It has two differences:

• The json meta-inf

• The word composition

It features the length of the non-truncated and truncated words are the respective values of the from and to keys.

{
    "comments" : "Final set (Intersect of 2 sets) - (Union of 0 sets)",
    "size" : 4,
    "codec" : "twobits",
    "from" : 23,
    "to" : 3
}

One line by truncated word that respect the constraints. Each line features the integer representation of one truncated word, its number of occurences and the list of its corresponding full-length words as an array of their integer representation values.

eg: A truncated word of value 31 has 425900 occurences and 237513503 is the value of one of its full-length word.

31:425900[237513503, ... ,10600922015]