A Python3 framework to simulate read counts in a ChIP-seq experiment.
ChIPulate requires the following Python3 libraries installed --- argparse
,numpy
,scipy
, pybedtools
and pandas
. ChIPulate has been tested to work with these versions of these libraries ---
argparse : 1.1
numpy : 1.15.2
scipy : 1.1.0
pandas : 0.23.4
pybedtools : 0.8.0
These packages can be installed using the Python3 pip
installer with the command pip3 install <package>
. In addition, pybedtools
needs bedtools
to be pre-installed on the system in order to run.
usage: chipulate.py [-h] [--mu-A MU_A] [--mu-B MU_B]
[-c CONTROL_CELL_FRACTION] [-b INPUT_BG] [-n NUM_CELLS]
[-d DEPTH] [-p PCR_CYCLES] -i INPUT_FILE
[--chrom-size-file CHROM_SIZE_FILE] [-g GENOME_FILE]
[-o OUTPUT_PREFIX] [--output-dir OUTPUT_DIR]
[--read-length READ_LENGTH]
[--fragment-length FRAGMENT_LENGTH]
[--fragment-jitter FRAGMENT_JITTER]
The ChIPulate pipeline for simulating read counts in a ChIP-seq experiment
optional arguments:
-h, --help show this help message and exit
--mu-A MU_A Chemical potential (in units of k_B T) of TF A, where
A is the target TF of the ChIP-seq. (default: 3.0)
--mu-B MU_B Chemical potential (in units of k_B T) of TF B, where
B is a second TF that may be involved in cooperative
or indirect interactions with A, the target TF of the
ChIP-seq. (default: 3.0)
-c CONTROL_CELL_FRACTION, --control-cell-fraction CONTROL_CELL_FRACTION
Control cell ratio. This is the fraction ofthe number
of cells used in the ChIP sample that is used for the
control sample. This value should be between 0 and 1.
Setting this parameter to 1 sets the number of cells
used in the ChIP and control samples to 1. (default:
0.1)
-b INPUT_BG, --input-bg INPUT_BG
Background binding energy (in units of k_BT) in the
input sample of the ChIP-seq experiment. Must be less
than the unbound energy. A higher value indicates
weaker binding in the input sample. (default: 1.0)
-n NUM_CELLS, --num-cells NUM_CELLS
Number of cells used in the ChIP sample of the
experiment. A progressive increase in this value slows
down the simulation. (default: 100000)
-d DEPTH, --depth DEPTH
Sequencing depth. We define this as the number of
reads expected per binding location if an equal number
of reads came from each location. The total number of
sequence reads used is the product of the sequencing
depth and the number of binding locations. A
fractional value can be passed if the total number of
reads is less than the number of binding locations.
The depth is set to be equal in both ChIP and input
samples. (default: 100)
-p PCR_CYCLES, --pcr-cycles PCR_CYCLES
Number of cycles employed in the PCR amplification
step. (default: 15)
-i INPUT_FILE, --input-file INPUT_FILE
File name of a tab-separated file that contains
location-wise information about the genome being
simulated and the experimental parameters of the ChIP-
seq. Each line contains an entry of the form <p_ext>
<p_amp> <binding_energy_A> <|binding_energy_B|>
<|binding_type|> <|interaction energy|> <|sequence|>
<|chrom_accessibility|>, where the columns enclosed in
|..| are optional. See README for more information on
each column. (default: None)
--chrom-size-file CHROM_SIZE_FILE
File containing sizes of each chromosome. This
argument is ignored when the chr, start and end
columns are not specified in the input file. If these
columns are specified, a tab-separated file where the
first two columns contain the chromosome name and
size, respectively, must be supplied. (default: )
-g GENOME_FILE, --genome-file GENOME_FILE
File containing a genome sequence in FASTA format. If
FASTA output is requested (by specifying the chr,
start and end columns in the input file), a single
FASTA file containing the genome sequence must be
specified. If chr, start and end columns are not
specified in the input, then this argument is ignored.
(default: )
-o OUTPUT_PREFIX, --output-prefix OUTPUT_PREFIX
Prefix of the output file. The\ output is a tab
separated file that lists the following\ columns ---
<chip_reads> <unique_chip_reads> <control_reads>\
<unique_control_reads>. See README for more
information on\ each column. (default: None)
--output-dir OUTPUT_DIR
Directory to which all output should be written.
Ensure that you have write privileges to this
directory. (default: None)
--read-length READ_LENGTH
Read length (in base pairs) to simulate. This must be
smaller than the fragment length(s) specified in the
--fragment-length argument, and is a required argument
if FASTQ output is requested. Only single-end reads
are simulated. (default: 150)
--fragment-length FRAGMENT_LENGTH
Fragment length (in base pairs) to simulate. This must
be larger than the read length specified for --read-
length. (default: 200)
--fragment-jitter FRAGMENT_JITTER
Variation in the starting position of fragments (in
base pairs) at a genomic region. A larger value leads
to a greater variation in start positions of fragments
in the ChIP sample only. This parameter does not
affect the starting position of fragments in the
control sample. (default: 20)
--library-type LIBRARY_TYPE
Type of sequencing library. This can be set to either
"single-end" or "paired-end". If single-end is
specified, a single BED and FASTQ file is generated
for ChIP and control samples. If "paired-end" is
specified, paired-end reads are simulated. In this
case, two sets of BED and FASTQ files are produced for
each of the ChIP and control samples.The BED and FASTQ
files containing reads from the forward and reverse
strands are suffixed with _R1 and _R2, respectively.
(default: single-end)
The header of the GENOME_FILE input must contain the following column items, of which p_ext
, p_amp
and energy_A
are the minimum columns that must be specified to run ChIPulate (see the Examples section of the README). The GENOME_FILE columns represent the following quantities:
chr --- Chromosome coordinate of each genomic region. This is mandatory for BED and FASTQ files to be generated.
start --- Starting position of each genomic region. This is mandatory for BED and FASTQ files to be generated.
end ---- End position of each genomic region. This is mandatory for BED and FASTQ files to be generated.
name --- Names for each entry. This is optional. If this column is not specified, each entry will be called region_1, region_2, ... .
p_ext --- The extraction efficiency at each genomic location. The value must
lie between 0 and 1.
p_amp --- PCR efficiency at each genomic location, which must lie between 0
and 1. The mean number of amplified fragments at a location is (1 + p)^n, where
p is the PCR efficiency at the location and n is the number of PCR cycles. Note
that the PCR efficiencies are truncated to two decimal places in order to speed
up the process of computing the number of amplified fragments obtained at each
genomic location.
energy_A --- Binding energies of TF A at each location, which is the
target TF of the ChIP-seq. A binding energy of 0 represents the strongest
binding site with positive values representing weaker binding.
energy_B --- Binding energies of TF B at each location. This is only
in case a second TF is being simulated.
binding_type --- When no second TF is supplied, every location is considered
to be directly bound by the TF A i.e., the value at each location defaults to
"direct". If a second TF is supplied, the binding_type can be either be
"direct" or "indirect".
int_energy--- When binding energies for A and B are supplied, the
interaction energy at each location determines whether it is cooperatively,
competitively or independently bound. At a given location, a negative value
represents a cooperative interaction, a positive value represents a competitive
interaction and a value of zero represents no interaction i.e., independent
binding.
sequence--- The sequence of the region being bound. This sequence can be of
any length.
chrom_accessibility--- The chromatin accessibility at each location. This is
a value that lies between 0 and 1.
The main output file, with the extension .chipulate.out
, is a tsv file that includes the following columns in addition to the columns specified in the input file ---
chip_reads --- The number of reads in the ChIP sample at each genomic
location. This includes both unique reads and duplicate reads arising from
sequencing PCR duplicate fragments during library preparation.
unique_chip_reads --- The number of unique reads in the ChIP sample at each
genomic location.
control_reads --- The number of reads in the control sample at each genomic
location. This includes both unique reads and duplicate reads arising from
sequencing PCR duplicate fragments during library preparation.
unique_control_reads --- The number of unique reads in the control sample at
each genomic location.
Two more files are generated in addition to the .chipulate.out
file, which are suffixed with .chipulate.out.run_info
and .chipulate.out.diag_output
. The run_info file conains the parameters with which the output was generated while the '.diag_output' contains results from the intermediate steps of computation when the read counts are generated. See
the Examples section for more details.
If chr
,start
and end
positions are supplied in the input file, then additional .bed
and .fastq
files are generated by ChIPulate, one each for the ChIP and control samples. The .bed
file generated contains six columns (these are the first six columns of the standard BED format https://genome.ucsc.edu/FAQ/FAQformat.html#format1). These columns are coordinates of single-end reads, the name of each read (with duplicates marked), and the strand from which they originated. The .fastq
files contain the sequences of each read, along with a fixed quality score of each read in the phred+33 scale.
The file basicExample.tsv
in the examples
folder is the minimum working input required to run chipulate.py
. The contents of the file are the following (10 locations are being simulated in this example) ---
p_ext p_amp energy_A
0.539179 0.18 0.15
0.505944 0.58 0.15
0.498672 0.58 0.41
0.479857 0.79 0.15
0.494356 0.58 0.15
0.554812 0.58 0.15
0.545281 0.38 0.41
0.492197 0.58 0.41
0.503651 0.58 0.41
0.578344 0.28 0.15
To execute chipulate.py
on this file with the remaining parameters set to their default values, run the following command ---
python3 chipulate.py -i basicExample.tsv
No output file is specified in the above syntax. When this is the case, the input file name is used as a prefix to generate the three output files described above. In this case, the files are named basicExample.tsv.chipulate.out
(the main output file), basicExample.tsv.chipulate.out.diag_output
(contains intermediate output from ChIPulate along with the output from the main output file) and basicExample.tsv.chipulate.run_info
(contains run information about the parameters of the simulation).
In a run of the command python3 chipulate.py -i basicExample.tsv
, the contents of basicExample.tsv.chipulate.out
are ---
p_ext p_amp energy_A chip_reads unique_chip_reads control_reads unique_control_reads
0.539179 0.18 0.15 0 0 0 0
0.505944 0.58 0.15 84 70 82 66
0.498672 0.58 0.41 84 66 98 81
0.479857 0.79 0.15 481 185 487 187
0.494356 0.58 0.15 73 57 76 65
0.554812 0.58 0.15 71 58 77 69
0.545281 0.38 0.41 11 11 6 6
0.49219700000000005 0.58 0.41 81 66 75 64
0.5036510000000001 0.58 0.41 109 80 93 71
0.578344 0.28 0.15 6 5 6 6
The information on the parameters used to generate this output are in basicExample.tsv.chipulate.out.run_info
---
Number of cells in ChIP sample : 100000
Control cell ratio : 0.1
Number of cells in control sample : 10000
Chemical Potential of A : 3.0
Number of PCR cycles : 15
Sequencing depth : 100
Total read count : 1000
The diagnostic output generated is in basicExample.tsv.chipulate.out.diag_output
---
name energy_A binding sequence p_occ_chip p_occ_bg chip_fragments control_fragments unique_control_reads control_reads unique_chip_reads chip_reads amp_control_fragments amp_chip_fragments ext_control_fragments ext_chip_fragments read_count_ratio
1 0.15 direct 0.9453186827840592 0.04742587317756678 94473 497 0 0 0 0 3396 2674 284 239
2 0.15 direct 0.9453186827840592 0.04742587317756678 94503 478 66 82 70 84 234729 204422 245 222 1.0606060606060606
3 0.41 direct 0.9302152171234199 0.04742587317756678 93037 463 81 98 66 84 238212 227874 243 233 0.8148148148148148
4 0.15 direct 0.9453186827840592 0.04742587317756678 94359 455 187 487 185 481 1298190 1352338 211 217 0.9893048128342246
5 0.15 direct 0.9453186827840592 0.04742587317756678 94461 465 65 76 57 73 215390 214698 235 224 0.8769230769230769
6 0.15 direct 0.9453186827840592 0.04742587317756678 94465 461 69 77 58 71 239417 251417 257 240 0.8405797101449275
7 0.41 direct 0.9302152171234199 0.04742587317756678 93046 472 6 6 11 11 31739 35954 248 265 1.8333333333333333
8 0.41 direct 0.9302152171234199 0.04742587317756678 93064 456 64 75 66 81 206097 221844 220 227 1.03125
9 0.41 direct 0.9302152171234199 0.04742587317756678 93089 456 71 93 80 109 209127 273018 221 260 1.1267605633802817
10 0.15 direct 0.9453186827840592 0.04742587317756678 94540 500 6 6 5 6 11240 11229 279 285 0.8333333333333334
The sequencing depth, chemical potential, number of cells used in the control sample, and the number of PCR cycles can be changed from the command line. The remaining experimental parameters such as extraction efficiency, amplification efficiency need to be changed in the input file.
The following command runs the file basicExample.tsv
with different parameters and the output prefix set to a user-defined value ---
python3 chipulate.py -i examples/basicExample.tsv --mu-A 1.5 --depth 300 --num-cells 10000 --control-cell-fraction 0.4 -o examples/mwe
The main output is now written to examples/mwe.chipulate.out
---
p_ext p_amp energy_A chip_reads unique_chip_reads control_reads unique_control_reads
0.539179 0.18 0.15 2 2 1 1
0.505944 0.58 0.15 207 64 240 84
0.498672 0.58 0.41 301 82 247 83
0.479857 0.79 0.15 1368 69 1513 91
0.494356 0.58 0.15 221 71 211 65
0.554812 0.58 0.15 264 85 234 80
0.545281 0.38 0.41 40 28 39 31
0.49219700000000005 0.58 0.41 261 84 240 84
0.5036510000000001 0.58 0.41 329 91 260 79
0.578344 0.28 0.15 7 7 15 13
The file examples/mwe.chipulate.run_info
shows the modified parameters ---
Number of cells in ChIP sample : 10000
Control cell ratio : 0.4
Number of cells in control sample : 4000
Chemical Potential of A : 1.5
Number of PCR cycles : 15
Sequencing depth : 300.0
Total read count : 3000.0
The diagnostic output is written to examples/mwe.chipulate.diag_output
---
name energy_A binding sequence p_occ_chip p_occ_bg chip_fragments control_fragments unique_control_reads control_reads unique_chip_reads chip_reads amp_control_fragments amp_chip_fragments ext_control_fragments ext_chip_fragments read_count_ratio
1 0.15 direct 0.7941296281990528 0.04742587317756678 7964 169 1 1 2 2 1096 1431 90 102 2.0
2 0.15 direct 0.7941296281990528 0.04742587317756678 7959 172 84 240 64 207 95250 65008 98 77 0.7619047619047619
3 0.41 direct 0.7483817216070642 0.04742587317756678 7487 181 83 247 82 301 88268 84959 93 94 0.9879518072289156
4 0.15 direct 0.7941296281990528 0.04742587317756678 7983 184 91 1513 69 1368 546708 436389 92 69 0.7582417582417582
5 0.15 direct 0.7941296281990528 0.04742587317756678 7907 163 65 211 71 221 64847 73790 71 79 1.0923076923076922
6 0.15 direct 0.7941296281990528 0.04742587317756678 7980 184 80 234 85 264 88031 90382 102 101 1.0625
7 0.41 direct 0.7483817216070642 0.04742587317756678 7451 193 31 39 28 40 13153 10078 100 82 0.9032258064516129
8 0.41 direct 0.7483817216070642 0.04742587317756678 7478 199 84 240 84 261 97850 88916 98 95 1.0
9 0.41 direct 0.7483817216070642 0.04742587317756678 7551 187 79 260 91 329 88385 103121 93 106 1.1518987341772151
10 0.15 direct 0.7941296281990528 0.04742587317756678 7963 191 13 15 7 7 4572 3334 102 84 0.5384615384615384
When indirect binding between two TFs is to be simulated, the binding_type
, energy_B
and int_energy
columns need to be specified. See examples/indirectExample.tsv
for an example. Its contents are pasted below ---
p_ext p_amp energy_A binding_type energy_B int_energy
0.539179 0.18 2.15 direct 0.20 0
0.505944 0.58 1.85 direct 0.20 0
0.498672 0.58 3.41 direct 0.31 0
0.479857 0 9.79 direct 2 0
0.494356 0.58 6.15 direct 0 0
0.554812 0.58 5.15 direct 0.20 0
0.545281 0.38 2.15 indirect 0 0
0.492197 0.58 1.85 indirect 0 0
0.503651 0.58 3.41 indirect 0 0
0.578344 0.28 9.79 indirect 0 0
0.578344 0.28 5.15 indirect 0 0
0.578344 0.28 2.15 indirect 0 0
After running ChIPulate with the command python3 chipulate.py -i examples/indirectExample.tsv -o examples/indirectExample
, the output is written to indirectExample.chipulate.out
---
p_ext p_amp energy_A binding_type energy_B int_energy chip_reads unique_chip_reads control_reads unique_control_reads
0.539179 0.18 2.15 direct 0.2 0 3 3 1 1
0.505944 0.58 1.85 direct 0.2 0 266 167 197 123
0.498672 0.58 3.41 direct 0.31 0 143 84 167 110
0.479857 0.0 9.79 direct 2.0 0 0 0 0 0
0.494356 0.58 6.15 direct 0.0 0 14 11 169 109
0.554812 0.58 5.15 direct 0.2 0 35 21 231 155
0.545281 0.38 2.15 indirect 0.0 0 35 32 25 25
0.49219700000000005 0.58 1.85 indirect 0.0 0 316 186 190 129
0.5036510000000001 0.58 3.41 indirect 0.0 0 319 197 194 114
0.578344 0.28 9.79 indirect 0.0 0 17 16 10 10
0.578344 0.28 5.15 indirect 0.0 0 30 29 10 10
0.578344 0.28 2.15 indirect 0.0 0 22 21 6 6
Simulating cooperative and competitive binding with ChIPulate, along with sequences at each location
In the example for indirect binding, all the interaction energies between both transcription factors are set to zero. To simulate cooperative or competitive binding, the interaction energies can be set to negative or positive values, respectively. The file coopExample.tsv
below shows an example of this, along with sequences to be associated with each location.
p_ext p_amp energy_A sequence binding_type energy_B int_energy
0.539179 0.18 0.15 GTCACGTGAT direct 0.20 -2
0.505944 0.58 0.15 GTCACGTGAT direct 0.20 -2
0.498672 0.58 0.41 ATCAGGTTAGCAGAT direct 0.31 -2
0.479857 0.79 0.15 GTCACGTATAAGAT direct 0 0
0.494356 0.58 0.15 GTCAtaaataCGTGAT direct 0 -1
0.554812 0.58 0.15 GTCAgacaCGTGAT direct 0.20 3
0.545281 0.38 0.41 ATCAGGTGAT direct 0.20 2
0.492197 0.58 0.41 ATCAGGTGAT direct 0.59 -1
0.503651 0.58 0.41 ATCAGGTGAT direct 0 0
0.578344 0.28 0.15 GTCACGTGAT direct 0.20 0
When the command python3 chipulate.py -i examples/coopExample.tsv --output-dir examples --output-prefix coopExample
is run, the output is written to examples/coopExample.chipulate.out
p_ext p_amp energy_A sequence binding_type energy_B int_energy chip_reads unique_chip_reads control_reads unique_control_reads
0.539179 0.18 0.15 GTCACGTGAT direct 0.2 -2 1 1 1 1
0.505944 0.58 0.15 GTCACGTGAT direct 0.2 -2 81 67 81 67
0.498672 0.58 0.41 ATCAGGTTAGCAGAT direct 0.31 -2 78 62 69 60
0.479857 0.79 0.15 GTCACGTATAAGAT direct 0.0 0 524 204 504 196
0.494356 0.58 0.15 GTCAtaaataCGTGAT direct 0.0 -1 60 50 77 61
0.554812 0.58 0.15 GTCAgacaCGTGAT direct 0.2 3 100 79 98 80
0.545281 0.38 0.41 ATCAGGTGAT direct 0.2 2 11 11 9 9
0.49219700000000005 0.58 0.41 ATCAGGTGAT direct 0.59 -1 63 56 83 70
0.5036510000000001 0.58 0.41 ATCAGGTGAT direct 0.0 0 78 63 71 54
0.578344 0.28 0.15 GTCACGTGAT direct 0.2 0 4 4 7 7
In order to run ChIPulate in FASTQ generation mode, genomic intervals need to be specified for each entry in the input file. An example of this is the examples/fastq-basicExample.tsv
file shown below---
chr start end p_ext p_amp energy_A
chr1 1523 1773 0.539179 0.18 0.15
chr1 5612 5862 0.505944 0.58 0.15
chr1 11241 11491 0.498672 0.58 0.41
chr1 11620 11870 0.479857 0.79 0.15
chr1 20066 20316 0.494356 0.58 1.15
chr1 22716 22966 0.554812 0.58 0.15
chr1 35534 35784 0.545281 0.38 0.41
chr1 48914 49164 0.492197 0.58 9.41
chr1 92766 93016 0.503651 0.58 0.41
chr1 156041 156241 0.578344 0.28 0.15
In addition to the chr
,start
and end
positions being supplied for each entry, the --genome-file
and --chrom-size-file
arguments must be supplied. The genome file must be a single FASTA file that contains the sequences of all chromosomes in the genome. The second argument should be a tab-separated file containing at least two columns, where the first two columns contain the chromosome name (with the same names as in the FASTA file) and the length of each chromosome. Such a file is commonly generated using the faidx
command from the samtools
suite.
If no chr
,start
and end
columns are supplied in the input file, the --genome-file
, --chrom-size-file
and other arguments related to the FASTQ generation mode (namely, --read-length
, --fragment-length
and --fragment-jitter
) will be disregarded, and no .bed
or .fastq
files will be output by ChIPulate.
The following command is a minimum working example of the FASTQ generation mode. The default fragment length used to generate fragments is 200 bp, the default read length is 150 bp and the fragment jitter is 20 bp (explained below).
python3 chipulate.py --input-file examples/fastq-basicExample.tsv --genome-file examples/yeast-genome.fa --chrom-size-file examples/yeast-genome.fa.fai --output-dir examples/
To run this example, ensure that the yeast-genome.fa.gz
file in the examples/
folder is extracted. The yeast-genome.fa.fai
provided in the examples/
folder was obtained by running the command samtools faidx yeast-genome.fa
, which gives the following contents---
chr1 230218 6 60 61
chr2 813184 234067 60 61
chr3 316620 1060811 60 61
chr4 1531933 1382714 60 61
chr5 576874 2940186 60 61
chr6 270161 3526681 60 61
chr7 1090940 3801351 60 61
chr8 562643 4910480 60 61
chr9 439888 5482507 60 61
chr10 745751 5929734 60 61
chr11 666816 6687922 60 61
chr12 1078177 7365859 60 61
chr13 924431 8462013 60 61
chr14 784333 9401859 60 61
chr15 1091291 10199272 60 61
chr16 948066 11308759 60 61
chrM 85779 12272633 60 61
The first two columns contain the chromosome names and sizes. Note that a file containing only the first two columns will suffice for ChIPulate. Any additional tab-separated columns provided will be ignored.
Two .bed
files are output from running the above command --- fastq-test.chip_reads.bed
and fastq-test.control_reads.bed
.
The first five lines of fastq-test.chip_reads.bed
generated in a sample run are ---
chr1 5659 5809 region_2_read_1 1 +
chr1 5632 5782 region_2_read_2 1 +
chr1 5713 5863 region_2_read_3 1 -
chr1 5629 5779 region_2_read_4 1 -
chr1 5701 5851 region_2_read_5 1 -
These five lines represent unique single-end reads that are not PCR duplicates. Duplicates reads carry the same name, as shown below for reads from region_4
---
chr1 11745 11895 region_4_read_40 1 -
chr1 11745 11895 region_4_read_40 1 -
In addition to these two .bed
files, two FASTQ files are generated --- fastq-test.chip_reads.fastq
and fastq-test.control_reads.fastq
. The first five entries of fastq-test.chip_reads.fastq
generated in a sample run are ---
@region_2_read_1(+)
ATCAAATGCACTAATATTGTAACGTTCTTACAAAGGGCAGACAACTTGAGAACTTTCATGCGTGCAACAGTATTAATATTTTACTGTCTTGATATCGTTATCCTCATCGTAACGTGAATTTTTTTGTCTCATACGTTAAGGTAAATTTTG
+
KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
@region_2_read_2(+)
CTTTATTATGTGGCCGAATCAACATTAATCAAATGCACTAATATTGTAACGTTCTTACAAAGGGCAGACAACTTGAGAACTTTCATGCGTGCAACAGTATTAATATTTTACTGTCTTGATATCGTTATCCTCATCGTAACGTGAATTTTT
+
KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
@region_2_read_3(-)
AAACAATAAAAGGGTGCTTTATACAGTAAGGCAAACAAGGACAACGGGGGTCATCAAAATTTACCTTAACGTATGAGACAAAAAAATTCACGTTACGATGAGGATAACGATATCAAGACAGTAAAATATTAATACTGTTGCACGCATGAA
+
KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
@region_2_read_4(-)
AATTCACGTTACGATGAGGATAACGATATCAAGACAGTAAAATATTAATACTGTTGCACGCATGAAAGTTCTCAAGTTGTCTGCCCTTTGTAAGAACGTTACAATATTAGTGCATTTGATTAATGTTGATTCGGCCACATAATAAAGTTT
+
KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
@region_2_read_5(-)
GGTGCTTTATACAGTAAGGCAAACAAGGACAACGGGGGTCATCAAAATTTACCTTAACGTATGAGACAAAAAAATTCACGTTACGATGAGGATAACGATATCAAGACAGTAAAATATTAATACTGTTGCACGCATGAAAGTTCTCAAGTT
+
The read names correspond to the read names generated in the respective BED files, and indicate the strand orientation (+/-
) in parentheses. By default, the maximum base quality is set at K
in the Phred-33 scale.
The figure below is a snap-shot of reads aligned to region_7
. To generate this image, reads from both chip and control samples were aligned to the yeast genome (examples/yeast-genome.fa
) using bwa
, and the resulting SAM files were converted to BAM, sorted, and indexed, using samtools
. The sorted BAM files obtained were input to Integrated Genome Viewer (IGV). The reads aligned to region_7
(the genomic interval chr1:35534-35784
) in both ChIP and input samples are shown below ---
The read length and fragment length can be altered by specifying the --read-length
and --fragment-length
parameter. In the snapshot above, these were both set to their default values (150 bp and 200 bp respectively). The --fragment-jitter
parameter was set to 20 bp. An increase in the --fragment-jitter
parameter "smears" out the reads by increasing the variability of the start positions of fragments. To see this, run the following command, where the fragment jitter is set to 50 bp ---
python3 chipulate.py --input-file examples/fastq-basicExample.tsv --genome-file examples/yeast-genome.fa --chrom-size-file examples/yeast-genome.fa.fai --output-dir examples/ --fragment-jitter 50
The reads obtained from this run are shown in the snapshot below. The increase in the apparent extent of the peak in region_7
can be clearly seen.
Specifying --libraryType paired-end
allows ChIPulate to output paired-end reads ---
python3 chipulate.py --input-file examples/fastq-basicExample.tsv --genome-file examples/yeast-genome.fa --chrom-size-file examples/yeast-genome.fa.fai --output-dir examples/
In this case, two sets of BED and FASTQ files are generated for the ChIP and control samples. Reads mapping to the forward strands are stored in files suffixed with _R1
and those mapping to the reverse strand are stored in files suffixed with _R2
. The above command creates four BED files and four FASTQ files in theexamples/
folder with the filename prefixes as fastq-test.chip_reads_R1.bed
,fastq-test.chip_reads_R2
, fastq-test.control_reads_R1
, fastq-test.control_reads_R2
. The read names in the _R1
file end in /1
and the read from the other end of the fragment ends in /2
. An example is shown below from fastq-test.chip_reads_R1.fastq
and fastq-test.chip_reads_R2.fastq
---
The first five reads in fast-test.chip_reads_R1.fastq
are
@region_2_read_1/1
CAAATGCACTAATATTGTAACGTTCTTACAAAGGGCAGACAACTTGAGAACTTTCATGCGTGCAACAGTATTAATATTTTACTGTCTTGATATCGTTATCCTCATCGTAACGTGAATTTTTTTGTCTCATACGTTAAGGTAAATTTTGAT
+
KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
@region_2_read_2/1
TATTATGTGGCCGAATCAACATTAATCAAATGCACTAATATTGTAACGTTCTTACAAAGGGCAGACAACTTGAGAACTTTCATGCGTGCAACAGTATTAATATTTTACTGTCTTGATATCGTTATCCTCATCGTAACGTGAATTTTTTTG
+
KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
@region_2_read_3/1
TGTGGCCGAATCAACATTAATCAAATGCACTAATATTGTAACGTTCTTACAAAGGGCAGACAACTTGAGAACTTTCATGCGTGCAACAGTATTAATATTTTACTGTCTTGATATCGTTATCCTCATCGTAACGTGAATTTTTTTGTCTCA
+
KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
@region_2_read_4/1
TTATTATGTGGCCGAATCAACATTAATCAAATGCACTAATATTGTAACGTTCTTACAAAGGGCAGACAACTTGAGAACTTTCATGCGTGCAACAGTATTAATATTTTACTGTCTTGATATCGTTATCCTCATCGTAACGTGAATTTTTTT
+
KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
@region_2_read_5/1
AACTTTATTATGTGGCCGAATCAACATTAATCAAATGCACTAATATTGTAACGTTCTTACAAAGGGCAGACAACTTGAGAACTTTCATGCGTGCAACAGTATTAATATTTTACTGTCTTGATATCGTTATCCTCATCGTAACGTGAATTT
+
The corresponding reads from the reverse strand, stored in fastq-test.chip_reads_R2.fastq
are
@region_2_read_1/2
ACAATAAAAGGGTGCTTTATACAGTAAGGCAAACAAGGACAACGGGGGTCATCAAAATTTACCTTAACGTATGAGACAAAAAAATTCACGTTACGATGAGGATAACGATATCAAGACAGTAAAATATTAATACTGTTGCACGCATGAAAG
+
KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
@region_2_read_2/2
AGGCAAACAAGGACAACGGGGGTCATCAAAATTTACCTTAACGTATGAGACAAAAAAATTCACGTTACGATGAGGATAACGATATCAAGACAGTAAAATATTAATACTGTTGCACGCATGAAAGTTCTCAAGTTGTCTGCCCTTTGTAAG
+
KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
@region_2_read_3/2
CAGTAAGGCAAACAAGGACAACGGGGGTCATCAAAATTTACCTTAACGTATGAGACAAAAAAATTCACGTTACGATGAGGATAACGATATCAAGACAGTAAAATATTAATACTGTTGCACGCATGAAAGTTCTCAAGTTGTCTGCCCTTT
+
KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
@region_2_read_4/2
GGCAAACAAGGACAACGGGGGTCATCAAAATTTACCTTAACGTATGAGACAAAAAAATTCACGTTACGATGAGGATAACGATATCAAGACAGTAAAATATTAATACTGTTGCACGCATGAAAGTTCTCAAGTTGTCTGCCCTTTGTAAGA
+
KKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKK
@region_2_read_5/2
AACAAGGACAACGGGGGTCATCAAAATTTACCTTAACGTATGAGACAAAAAAATTCACGTTACGATGAGGATAACGATATCAAGACAGTAAAATATTAATACTGTTGCACGCATGAAAGTTCTCAAGTTGTCTGCCCTTTGTAAGAACGT
+
The reads in the _R1
and _R2
files are designed to map in the FR
orientation, with a fixed insert size that is equal to the fragment length specified by the --fragment-length
parameter. The IGV snapshot below was obtained from running ChIPulate with a read length of 50 bp in paired end mode, where the fragment length is left at the default value of 200 bp ---
python3 chipulate.py --input-file examples/fastq-basicExample.tsv --genome-file examples/yeast-genome.fa --chrom-size-file examples/yeast-genome.fa.fai --output-dir examples/ --library-type paired-end --read-length 50
In the basic example above, the summit of each peak region passed into ChIPulate is assumed to be the midpoint between the start
and end
coordinate of each region. ChIPulate considers the summit to be the location at which a binding event has occurred, and thus assumes that the mid-points of fragments in the ChIP sample are centered at the summit.
If a summit
column is specified in the input file, where the summit position is defined with respect to the start
position of each genomic region, then ChIPulate will use this column as the location of the TF-DNA binding event in each region. The following is a way of specifying the summits for each region ---
chr start end summit p_ext p_amp energy_A
chr1 1523 1773 74 0.539179 0.18 0.15
chr1 5612 5862 103 0.505944 0.58 0.15
chr1 11241 11491 100 0.498672 0.58 0.41
chr1 11620 11870 43 0.479857 0.79 0.15
chr1 20066 20316 18 0.494356 0.58 1.15
chr1 22716 22966 127 0.554812 0.58 0.15
chr1 35534 35784 87 0.545281 0.38 0.41
chr1 48914 49164 17 0.492197 0.58 9.41
chr1 92766 93016 175 0.503651 0.58 0.41
chr1 156041 156241 120 0.578344 0.28 0.15
The summit in the first region is thus 74
bp inside the region chr1:1524-1773
and is thus located at chr1:1598
.
A ChIP-seq peak with multiple binding events and thus, multiple summits, can be simulated by providing multiple entries in the input file that share the same (chr,start,end)
coordinates but possess different summits ---
chr start end summit p_ext p_amp energy_A
chr1 1523 1773 74 0.539179 0.18 0.15
chr1 5612 5862 103 0.505944 0.58 0.15
chr1 11241 11491 100 0.498672 0.58 0.41
chr1 11620 11870 43 0.479857 0.79 0.15
chr1 20066 20316 18 0.494356 0.58 1.15
chr1 20066 20316 58 0.494356 0.58 2.90
chr1 20066 20316 123 0.494356 0.58 1.55
chr1 22716 22966 127 0.554812 0.58 0.15
chr1 35534 35784 87 0.545281 0.38 0.41
chr1 48914 49164 17 0.492197 0.58 9.41
chr1 92766 93016 175 0.503651 0.58 0.41
chr1 156041 156241 120 0.578344 0.28 0.15
In the example above, the peak chr1:20066-20316
contains three summits at positions 18,58
and 123
. Note that the binding energies and other parameters can differ between these entries.
If no name
column is specified in the input file, ChIPulate will refer to each location as region_1
,region_2
,... . A name
column can be specified as below ---
chr start end name summit p_ext p_amp energy_A
chr1 1523 1773 peak_1 74 0.539179 0.18 0.15
chr1 5612 5862 peak_100 103 0.505944 0.58 0.15
chr1 11241 11491 peak_50 100 0.498672 0.58 0.41
chr1 11620 11870 peak_20 43 0.479857 0.79 0.15
chr1 20066 20316 peak_21 18 0.494356 0.58 1.15
chr1 20066 20316 peak_21_summit_2 58 0.494356 0.58 2.90
chr1 20066 20316 peak_21_diffmotif 123 0.494356 0.58 1.55
chr1 22716 22966 false_pos_1 127 0.554812 0.58 0.15
chr1 35534 35784 false_pos_2 87 0.545281 0.38 0.41
chr1 48914 49164 hotspot_3 17 0.492197 0.58 9.41
chr1 92766 93016 hotspot_15 175 0.503651 0.58 0.41
chr1 156041 156241 peak_121 120 0.578344 0.28 0.15
The name supplied to each region need not be unique and this will not cause any error in the ChIPulate output. However, this may make it more difficult to mark duplicate reads based on the name of the read. For this reason, it is recommended that the name
column contain unique entries, or is left blank unless needed.
The running time of ChIPulate is largely determined by the number of amplified fragments that are generated during the simulation. The parameters that increase the number of amplified fragments generated (while other parameters are held constant) are ---
- A decrease in the binding energies across the genome (
energy_A
and/orenergy_B
in input file). This increases the occupancy probability of locations, which gives rise to more bound fragments. - A decreaase in the background binding energy in the input sample (
--input-bg
command-line switch). - An increase in the chemical potential (
--mu_A
and/or--mu-B
command-line switches). This is increases the occupancy probability of all genomic locations. - An increase in the number of genomic locations.
- An increase in the number of cells (
--num-cells
command-line switch). - an increase in the control cell fraction (
--control-cell-fraction
command-line switch). - An increase in the extraction efficiency (
p_ext
column in input file). - An increase in the PCR efficiency (
p_amp
column in input file) and/or the number of PCR cycles (--pcr-cycles command-line switch). The input file to ChIPulate requires PCR efficiencies to be input to the program. See the PCR efficiency -> Amplification ratio conversion table for how efficiencies map to amplification ratios for guiding choices of this parameter. Note : It is recommended to usen = 15
cycles of PCR whenever possible for purposes of speed. See the section "PCR simulation process" for more information. - An increase in chromatin accessibility (
chrom_accessibility
column in input file).
The key quantity to control while setting the PCR efficiency column in the input file is the amplification ratio. This is defined as A = (1 + p)^{n}, where A is the amplification ratio, p is the PCR efficiency and n is the number of PCR cycles. The table below gives values of p and n and the amplification ratios corresponding to them.
A | p = 0.1 | p=0.25 | p=0.5 | p=0.75 | p=0.9 |
---|---|---|---|---|---|
n=10 | 2.59 | 9.31 | 57.67 | 269.39 | 613.11 |
n=12 | 3.14 | 14.55 | 129.75 | 825.01 | 2213.31 |
n=15 | 4.18 | 28.42 | 437.89 | 4421.51 | 15181.13 |
n=18 | 5.56 | 55.51 | 1477.89 | 23696.54 | 104127.35 |
The probability mass functions of the number of amplified fragments obtained after 15 cycles of PCR are present in the output/pcr-data/
folder. This considerably speeds up the simulation process since this distribution does not have to be computed afresh. These are files named 15-0.01.npy
, 15-0.02.npy
to 15-0.99.npy
. The filename convention is <number of cycles>-<PCR efficiency>.npy
. Note that if PCR efficiencies other than these values are specified in the p_amp
column in the input file, they will be rounded down to 2 decimal places.
This is because the computation of the probability mass function of the number of amplified fragments obtained from a single fragment becomes a slow process beyond --pcr-cycles
command-line switch. ChIPulate will first compute these distributions for all efficiencies between 0.01 and 0.99 in steps of 0.01 and then store them in the output/pcr-data/
for future use. Later runs of ChIPulate with this number of PCR cycles will then be fast since these stored distributions will be loaded from disk.
The paper/
folder contains a jupyter notebook (Manuscript.ipynb
) that can be executed to reproduce the results in our manuscript. An additional download is required to run the last cell of the notebook. Instructions for this are provided within the notebook itself.
Email [email protected] in case of any issues.
This project is licensed under the MIT License - see the LICENSE.md file for details
Vishaka Datta S
- Sridhar Hannenhalli, Rahul Siddharthan for helping set up each aspect of the ChIPulate pipeline.
- Sandeep Krishna, Gautam Menon for useful discussions on the binding model employed in ChIPulate.
- Parul Singh for discussions on the ChIP-seq protocol and peak callers.