Comments (5)
For -s 21 I get the same segfault for another k-mer:
kmer: GGCTCACGAATTGTAACACA int: 1039706809617 hash: 872651690707
Thread 2 "squeakr-count" received signal SIGSEGV, Segmentation fault.
[Switching to Thread 0x7fffae0ce700 (LWP 29009)]
0x000000000043f60a in shift_remainders (qf=0x7fffffffbd00, start_index=1677734,
empty_index=2112650) at threadsafe-gqf/gqf.c:716
(gdb) bt
#0 0x000000000043f60a in shift_remainders (qf=0x7fffffffbd00, start_index=1677734,
empty_index=2112650) at threadsafe-gqf/gqf.c:716
#1 0x0000000000440f26 in insert1(QF *, __int128 unsigned, bool, bool) (
qf=0x7fffffffbd00, hash=872651690707, lock=true, spin=false)
at threadsafe-gqf/gqf.c:1362
#2 0x0000000000442378 in qf_insert (qf=0x7fffffffbd00, key=872651690707, value=0,
count=1, lock=true, spin=false) at threadsafe-gqf/gqf.c:1816
#3 0x0000000000409821 in reads_to_kmers (c=..., obj=0x66e270) at main.cc:338
#4 0x0000000000409b1d in fastq_to_uint64kmers_prod (obj=0x66e270) at main.cc:379
...
from squeakr.
Finally I tried to compile with #define BITS_PER_SLOT 64
to force using the other shift_remainders implementation.
Again it segfaulted:
gdb --args squeakr-count -f -k 20 -s 20 -t 1 -o cqfs/ raw/SRR1660308.fastq
...
kmer: GGATGTCTGTGTGTTCTATT int: 1060369262746 hash: 674258092905
Thread 2 "squeakr-count" received signal SIGSEGV, Segmentation fault.
[Switching to Thread 0x7fffadd3d700 (LWP 30643)]
0x00007fffae8ac947 in memmove () from /lib64/libc.so.6
(gdb) bt
#0 0x00007fffae8ac947 in memmove () from /lib64/libc.so.6
#1 0x000000000043f3cc in shift_remainders (qf=0x7fffffffbd00, start_index=650765,
empty_index=1058979) at threadsafe-gqf/gqf.c:689
#2 0x0000000000440ca0 in insert1(QF *, __int128 unsigned, bool, bool) (
qf=0x7fffffffbd00, hash=674258092905, lock=true, spin=false)
at threadsafe-gqf/gqf.c:1362
#3 0x00000000004420ed in qf_insert (qf=0x7fffffffbd00, key=674258092905, value=0,
count=1, lock=true, spin=false) at threadsafe-gqf/gqf.c:1816
#4 0x0000000000409821 in reads_to_kmers (c=..., obj=0x66d270) at main.cc:338
#5 0x0000000000409b1d in fastq_to_uint64kmers_prod (obj=0x66d270) at main.cc:379
...
I suppose shift_remainders should be called with an empty_index < 2^log_n_slots?
Cheers
from squeakr.
I browsed the other issues and I think I understand that this is related to setting log_n_slots too small. I will try with the method you described in #17 and report back.
Cheers
from squeakr.
from squeakr.
With sufficently high log n_slots setting it runs without segfaulting.
from squeakr.
Related Issues (20)
- Doc command line doesn't much help HOT 3
- Add a --version or -v flag
- Command line parsing seems to be broken in exact branch HOT 1
- squeakr-query "Not Find: 0" HOT 3
- Plans to support FASTA? HOT 2
- lognumslots.sh sometimes underestimates the required number of slots HOT 2
- Segmentation fault while counting human genome HOT 7
- Update release? HOT 6
- Can't install on OSX, expected identifier FREAD HOT 3
- boost/thread/thread.hpp error installing on macOS HOT 3
- Release 0.6 prints 1.0 with help -v HOT 1
- MacOS: use of undeclared identifier 'posix_fallocate' HOT 3
- gqf/partitioned_counter.c:15:10: fatal error: 'sys/sysinfo.h' file not found
- endless loop in /src/count.cc HOT 1
- /src/count.cc can silently drop input files HOT 2
- Illegal instruction error HOT 4
- long reads?
- Assertion `new_value < current_remainder' failed. HOT 5
- Segmentation fault
- Error opening file for serializing.: Is a directory HOT 3
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from squeakr.