protein fasta file with empty first line about mhcquant HOT 8 CLOSED

Thank you for opening this issue.

We now added the information to the troubleshooting, that there should be no empty lines in your fasta database.

from mhcquant.

Dear Leon,
I guess the empty line was generated by the " generate_proteins_from_vcf" step because I double-checked and found no empty lines in the input VCF and reference fasta.

from mhcquant.

hmm... ok did it run through anyway in the end?

from mhcquant.

no.. it stopped at the "generate_decoy _database" step.

However, when I manually removed the empty line from the "UP000005640_9606_reviewed_added_vcf.fasta" and restarted the workflow with "-resume", then it runs through successfully till the end.

from mhcquant.

ok can you send me the input files, I will have a look.

from mhcquant.

Error executing process > 'generate_decoy_database (1)'

Caused by:
Process generate_decoy_database (1) terminated with an error exit status (3)

Command executed:

DecoyDatabase -in Hops_HopBase_v5_maskedCascadePrimary_repeatsRemoved.cds.fasta
-out Hops_HopBase_v5_maskedCascadePrimary_repeatsRemoved.cds_decoy.fasta
-decoy_string DECOY_
-decoy_string_position prefix
> Hops_HopBase_v5_maskedCascadePrimary_repeatsRemoved.cds_decoy_database.log

Command exit status:
3

Command output:
(empty)

Work dir:
/wsu/home/gb/gb35/gb3520/work/94/554d8e4df2dc954f5637e186c969e4

Tip: you can try to figure out what's wrong by changing to the process work dir and showing the script file named .command.sh

When I check the log file I get this:

Error: Unable to read file (Cannot convert string to amino acid sequence: unexpected character 'a' in: atgaccctagaagctcatccaccacctcctcacaacccttcacatgtcctgcaggtcgtccaagtcgagccccaattaccacgatcccaggccatagaggcgagaccctcagcgaccatcctcgactctgtgttggggatgactatgacttcttgcatggctcagatccatactattgctcagatccaagctgaggtggatgaggccaggactgctttgggggaggtgaaggtcaccttggaggaggccaatgccatgaagtatgccctggacaaggccaaaaatgcccttaagacctcccacgcgaatgagaaaattgccaaaacacaagtcttgaagaaccaggaaggggatttatcattcctagacgaggaactttgggggcgctacctcaccatgtttcaagaccgattatcaaaagagtcggcgaagacagtggagacttcaagagctgtagcagaaggcagggaggaagaggtatcatcttga)

from mhcquant.

Hey in this case it is complaining that you are using a DNA sequence. Your database should only contain protein sequences. (Capital letter canonical Aminoacids)

from mhcquant.

Whoops, thank you!

from mhcquant.