Comments (4)
These are the only two files in the 'processed' folder? Based on the logfile the script appears to be merging paired ends reads correctly, although if this is 250 bp reads then you should change one of the settings. In that processed folder do you then see a single file for each of your samples, i.e. V4.fastq
?
What primers did you use for amplification and sequencing? The default settings are the ITS2 region using fITS7 and ITS4 primers. You can specify different primers using the -f
and -r
options. The default settings also assume that you used the Illumina TruSeq dual barcoding approach, where your reads look like this from the sequencing center and that the primers are intact:
5'primer-read-3'primer
So the script will only output reads where it can find the forward primer. If that is not your read structure, i.e. your primers are already removed then you need to pass the --require_primer off
option at runtime.
You should also set the --read_length 250
if you have PE 250 bp reads.
from amptk.
I do see a file for each of the samples. The issue may be this dataset only looks at ITS1.
What would the remainder of the script be for setting new forward and reverse primers?
from amptk.
So you would do something like this if it was ITS1-F and ITS2 primers - note you should add the actual primer sequences that you used that will remain after Illumina trims off their adapters and index sequences (typically this is just the normal primer). If you used the custom sequencing primers that are used in the community, i.e. from Smith et al. 2014 - then you need to pass the --require_primer off
option. The --rescue_forward
option will keep the forward reads if the paired reads cannot be merged.
ufits illumina -i rawdata -o process_ITS1 -f CTTGGTCATTTAGAGGAAGTAA \
-r GCTGCGTTCTTCATCGATGC --read_length 250 --rescue_forward
Remember that running any of the commands in UFITS without any options will output a help menu:
ufits illumina
Usage: ufits illumina <arguments>
version: 0.5.5
Description: Script takes a folder of Illumina MiSeq data that is already de-multiplexed and processes it for
clustering using UFITS. The default behavior is to: 1) merge the PE reads using USEARCH, 2) find and
trim away primers, 3) rename reads according to sample name, 4) trim/pad reads to a set length.
Arguments: -i, --fastq Input folder of FASTQ files (Required)
-o, --out Output folder name. Default: ufits-data
--reads Paired-end or forward reads. Default: paired [paired, forward]
--read_length Illumina Read length (250 if 2 x 250 bp run). Default: 300
--rescue_forward Rescue Forward Reads if PE do not merge, e.g. abnormally long amplicons
-f, --fwd_primer Forward primer sequence. Default: fITS7
-r, --rev_primer Reverse primer sequence Default: ITS4
--require_primer Require the Forward primer to be present. Default: on [on, off]
-n, --name_prefix Prefix for re-naming reads. Default: R_
-m, --min_len Minimum length read to keep. Default: 50
-l, --trim_len Length to trim/pad reads. Default: 250
--full_length Keep only full length sequences.
--cpus Number of CPUs to use. Default: all
-u, --usearch USEARCH executable. Default: usearch8
--cleanup Remove intermediate files.
from amptk.
Thank you very much. I think this should get me to where I need to be.
from amptk.
Related Issues (20)
- Issue installing AMPtk (Mac OS - M1 chip) HOT 2
- getting NoneType vs int error in clustering step
- Error when run quick start HOT 7
- usearch9 not found when generate UTAX database
- VSEARCH error on amptk -filter step
- Support Python 3.8 onwards HOT 3
- SyntaxError in "duplicate ID in mapping file: XXX, exiting"
- Default for -p, --index_bleed documented as 0.005 HOT 1
- Typo "Bjerkandara adusta" --> "Bjerkandera adusta" HOT 1
- Missing species names in amptk_mock1.fa HOT 3
- Missing final new line in amptk_mock1.fa and amptk_synmock.fa HOT 2
- Inconsistent primer trimming sequence in amptk_mock*.fa HOT 5
- Matching MockA, MockB1 and MockB2 to FASTQ filenames HOT 2
- platform.linux_distribution is removed since Python 3.8 HOT 1
- Species names in amptk_mock2.fa and amptk_mock3.fa vs Figure 4
- new users cannot install amptk properly, please help HOT 3
- unoise3 clustering HOT 5
- Problem with TypeError during AMPtk cluster HOT 11
- Saw you started some prelim ONT methods HOT 2
- Problematic unoise3 implementation with VSEARCH HOT 13
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from amptk.