Comments (6)
yeah, that seems possible though it may take a bit of rework (I think the Doench CFD score is the only that is meaningful for a single off-target).
from flashfry.
i think the program haved calculated Doench CFD score for every single off-target befor outputing DoenchCFD_maxOT, so what the score class need to motify is just including Doench CFD score in the offTargets column for every single off-target with score option --includeOTs, like this
AAAAATAGGGAAAAGGGCACCGG_1_4_Doench_CFD_score<2:838572^R>,ACAAATATAGCACATGCCACTGG_1_4Doench_CFD_score<5:220383333^F>
from flashfry.
I've put up a pre-release version 1.12a that supports this. During both the discover and score modules you'll need to have "--includeOTs" added to your command line. We have to support any number of these associated scores, so the output looks a little different than you proposed:
ACTGTCCCAGCAGCAGAAGAGGG_1_4chr22:48437007^R{Doench2016CFDScore=0.06444234483586098},
There are some more things to test, but I thought you might want to try it out.
from flashfry.
thank you very much, i'll have a try.
from flashfry.
from flashfry.
Waiting for the meta-analysis in CRISPOR2 to tell us a better metric :-)
from flashfry.
Related Issues (20)
- Best Scoring Matrix for CPF1 HOT 4
- rnafold4j.src.main.java.rnafold4j.RNAFoldAPI does not exist HOT 1
- doench2016cfd scoring with spcas9ngg19
- Parallelism on HPC clusters HOT 2
- 404 to link in paper HOT 1
- problem with genome fasta files with chromosome description HOT 4
- Discover module: Key not found: 0 error HOT 3
- Whole genome off-target scores
- Is random flanking sequence required? HOT 4
- guideRNA ranking HOT 2
- off-targets ranking HOT 2
- unexpected result HOT 12
- Score: TSV columns off-by-one? HOT 3
- Filtering gRNAs for GC% and homopolymers HOT 4
- CFD score threshold
- Export index data base ? HOT 1
- Run with multiple threads/cores? HOT 6
- issue parsing T2T-CHM13v2.0 during indexing HOT 1
- Designs for SpG Cas enzyme
- Add option/PAM for Staphylococcus aureus Cas9?
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from flashfry.