denovo_map.pl: Aborted because the last command failed (Error: Unable to load data) about genome-assembly-of-the-copepod-leptodiaptomus HOT 3 OPEN

Trying to check for permission problems, when ls -lh is run on the folder containing the input, it can be noticed that the files are very light ... so much so that some appear to be empty.

When running the head command with a random file, it turned out to be blank.

from genome-assembly-of-the-copepod-leptodiaptomus.

Error appears to be in how the radtags are being processed? Appears to be using only single-end sequences? Reason for this is still unknown

from genome-assembly-of-the-copepod-leptodiaptomus.

Your data does not seem to be a interleaved paired-end file. Here is an example of such files:

NGCTCCTAGGTCGGCATGATGGGGGAAGGAGAGCATGGGAAGAAATGAGAGAGTAGCAA
+
#8BCCGGGGGFEFECFGGGGGGGGG@;FFGGGEG@FF<EE<@FFC,CEGCCGGFF<FGF
@M10991:61:000000000-A7EML:1:1101:14011:1001 2:N:0:28
NGCTCCTAGGTCGGCATGACGCTAGCTACGATCGACTACGCTAGCATCGAGAGTAGCAA
+
#8BCCGGGGGFEFECFGGGGGGGGG@;FFGGGEG@FF<EE<@FFC,CEGCCGGFF<FGF
@M10991:61:000000000-A7EML:1:1201:15411:3101 1:N:0:28
NGCTCCTAGGTCGGCATGATGGGGGAAGGAGAGCATGGGAAGAAATGAGAGAGTAGCAA
+
#8BCCGGGGGFEFECFGGGGGGGGG@;FFGGGEG@FF<EE<@FFC,CEGCCGGFF<FGF
@M10991:61:000000000-A7EML:1:1201:15411:3101 2:N:0:28
CGCTAGCTACGACTCGACGACAGCGAACACGCGATCGATCGGAAATGAGAGAGTAGCAA
+
#8BCCGGGGGFEFECFGGGGGGGGG@;FFGGGEG@FF<EE<@FFC,CEGCCGGFF<FGF

This could be related either to a mistake during download or you could have filtered all (or at least the vast majority) of R2 reads in a quality filtering.

You could try treating your files as single end.

from genome-assembly-of-the-copepod-leptodiaptomus.