DHat is an efficient and using easily tool, it intergrate linker filtering, alignment, noise reduce and matrix building.
Dependence
Third software: bwa, mafft, python
Python module: matplotlib, scipy, argparse, numpy <= 1.14.2
Install
Before you use DHat you would better install some dependent tools.
Please ensure your server can connect to network.
Install Anaconda (Python 2.7 version)
$ wget https://repo.anaconda.com/archive/Anaconda2-2018.12-Linux-x86_64.sh
$ bash ./Anaconda2-2018.12-Linux-x86_64.sh -p ~/
$ conda install -c bioconda mafft
$ conda install -c bioconda bwa
Install Python module
Note: the version of numpy should be less than 1.14.2
$ pip install matplotlib
$ pip install scipy
$ pip install argparse
$ pip install numpy
Download and install JRE (necessary)
I am not sure the wget command can work well, you would better download JRE from webpage and then upload to server
$ wget https://download.oracle.com/otn-pub/java/jdk/8u201-b09/42970487e3af4f5aa5bca3f542482c60/jre-8u201-linux-x64.tar.gz
$ tar -zxf server-jre-8u201-linux-x64.tar.gz
$ export PATH=jre1.8.0_201/bin/:$PATH
If you don't want to execute the last command after you connect server each time, you can append this command to your file named ".barsh_profile" or use the following command
$ echo 'export PATH=jre1.8.0_201/bin/:$PATH' >> ~/.bash_profile
By now, we have installed all dependence, then you can download DHat.jar from this page. Then, install DHat
$ java -jar DHat.jar install
Usage: java -jar DHat.jar [options], you can get the all information of command options by java -jar DHat.jar
-conf <file> Configure file
-D,--Debug <int> Debug Level (default 0)
-i <file> input file
-o,--out <dir> Out put directory
-p <string> Prefix
-pbs running by pbs
-r,--res <ints> resolution
-s,--step <string> same as "Step" in configure file
-t,--thread <int> number of threads
DHat support many options, the most general usage of DHat is:
$ java -jar DHat.jar -conf <configure file>
Note: program will use default path ("path of DHat"/Resource/default.conf or "path of DHat"/Resource/default_adv.conf) if you don't set -conf or -adv
-
Set the configure file
After install DHat, there are two new directory: Script and Resource. The Script folder include some python script, Resource folder include a template of configure file.
download a test data copy template configure file
$ cp Resource/default.conf ./test.confedit test.conf and set value like following figure
$ vi test.conf
Note: The OutPath you set must be existed.
Note: If you don't know the HalfLinker or Restriction, you can set these parameters blank. The detail see [Linker detection](#Linker detection). -
Save your set and execute DHat
$ java -jar DHat.jar -conf test.conf > log.txt 2> err.txtProgram will print the configure information shortly
Configure file must keep to the follow format, and the line start with # will been ignored.
#------------------------------required parameters----------------------------
InputFile = DLO-test.fastq
GenomeFile = Hg19.clean.fna
#------------------------------optional parameters---------------------------
Restriction =
HalfLinker =
OutPath = ./
Prefix = out
Index = Hg19
Chromosomes =
AdapterSeq = auto
Resolutions = 1000000
DrawResolutions = 1000000
Thread = 4
Step = -
#------------------------------advance parameters---------------------------
MatchScore = 1
MisMatchScore = -1
InDelScore = -1
MinLinkerLen =
MinReadsLength = 16
MaxReadsLength = 20
AlignThread = 1
AlignType = Short
AlignMisMatch = 0
MinUniqueScore =
Bwa = bwa
Mafft = mafft
Python = python
Iteration = true
DeBugLevel = 0
explain
InputFile String Input File with Fastq Format
GenomeFile String Reference genome file
#===============================================================================
Restriction String Sequence of restriction, enzyme cutting site expressed by "^"
HalfLinker String[] Halflinker sequences (different half-linker separated with a space)
OutPath String Path of output (default "./")
Prefix String prefix of output (default "DLO_Out")
Index String Index prefix of reference genome
Chromosomes String[] Chromosome name must same as Chromosome name in reference genome (default all in reference genome)
AdapterSeq String[] Adapter sequence, null means don't remove adapter (default "")
If you want to remove adapter but you don't know the adapter seq, you can set "Auto"
Resolutions Int[] Bin size when create interaction matrix (default "1000000" byte)
DrawResolution Int[] Resolution for you draw heat-map (default "100000")
Thread Int Number of threads (default "4")
Step String[] assign where start and end (default "-")
#===============================================================================
MatchScore Int Match score in linker filter (default "1")
MisMatchScore Int MisMatch Score in linker filter (default "-1")
InDelScore Int Indel Score in linker filter (default "-1")
MinLinkerLen Int Minimum linker length
MinReadsLength Int Min reads length when extract interaction reads (default "16")
MaxReadsLength Int Max reads length when extract interaction reads (default "20")
AlignType String Reads type include ["Short","Long"] (default "Short")
AlignMisMatch Int MisMatch number in alignment (default "0")
MinUniqueScore Int Minimum mapQ what reads mapQ less than it will be removed
Bwa String The path of bwa execute file (include the execute file)
Mafft String The path of mafft execute file (include the execute file)
Python String The path of Python execute file (include the execute file)
Iteration Bool "true" or "false" represent whether do iteration alignment
DeBugLevel Int 0 means remain base output, 1 means more output, 2 means all output (default "0")
Note: If we set ReadsType "Short", we will align with bwa aln,and if set "Long",we will align with bwa mem.
Note: Step include "PreProcess" "Alignment" "Bed2BedPe" "NoiseReduce" "BedPe2Inter" "CreateMatrix"
Note: If we want to run from "Alignment" to "CreateMatrix", we can set "Alignment - CreateMatrix"
Note: If we only want to run from "Alignment" to end, we can set "Alignment -"
Note: If we want to run all, we can set "-"
java -cp DHat.jar Bin.Guide //use GUI
java -cp DHat.jar Utils.BedToBedpe
java -cp DHat.jar Utils.CalculateLineNumber
java -cp DHat.jar Utils.CreateMatrix
java -cp DHat.jar Utils.FastqExtract
java -cp DHat.jar Utils.PetCluster
java -cp DHat.jar Utils.RangeCount
java -cp DHat.jar Utils.SamFilter
java -cp DHat.jar Utils.PlotHeatMap
java -cp DHat.jar Utils.MatrixCorrelation
java -cp DHat.jar Component.tool.Annotation
java -cp DHat.jar Component.tool.LinkerDetection
If you don't know the value of parameter Restriction or HalfLinker, you can try to use the follow methods.
- use
java -cp DHat.jar Component.tool.LinkerDetection
usage:java -cp DHat.jar Component.tool.LinkerDetection -i <input file> [options]
argumentresult-i input file (fastq or fastq.gz format) -e restriction sequence such as A^AGCTT (default 'autiomatic detection', if you don't want to detect restriction sequence, please set 'no') -f threshold (default 0.05, highter value means less data remain) -k k-mer length (default 10) -n sequence number use to processing (default 5000)
The first line is restriction sequence, following is linker sequence, orientation and minimum kmer overlapC^CGG CGTCGGATTAGGTGTATCTAGATACACCTAATCCGACG + 760.0 CGTCGGAGAACCAGTAGCTAGCTACTGGTTCTCCGACG + 800.0 - set "Restriction" or "HalfLinker" empty.
for exampleRestriction = HalfLinker =
React
Typescript
Django
Laravel
Facebook
Microsoft
Google
Alibaba
D3
Tencent